Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 9 7
Marinobacter aqueolei 10 8
Marinobacter sp. ELB17 10 7
Oceanobacter sp. RED65 5 4
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40 3 2
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043 13 11
Reinekea sp. MED297 10 9
Alcanivorax borkumensis SK2 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Csal_2644
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -36
score = 4.99905
sequence = ATTCACACATACGTTTGCAT

Gene: Csal_2644: acyl-CoA dehydrogenase-like protein
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
acyl-CoA dehydrogenase-like protein
 
CRON 2.
fadL
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -132
score = 5.0196
sequence = ATTAAAACAAACGTTTGCTC

Gene: Csal_3004: Long-chain fatty acid transport protein
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Long-chain fatty acid transport protein
 
CRON 3.
fadE
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_3614: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Marinobacter sp. ELB17

Gene: MELB17_02235: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Oceanobacter sp. RED65

Gene: RED65_13337: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -39
score = 5.58356
sequence = ATTCAAACGCTCGTTAGAAT

Gene: Csal_1510: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Reinekea sp. MED297

Gene: MED297_11345: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Alcanivorax borkumensis SK2
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
CRON 4.
acdH4
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -138
score = 5.71062
sequence = TTTCAAACGCTTGTTTGACT

Gene: ABO_2102: Acyl-CoA dehydrogenase (EC 1.3.99.3)
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 5.
MED297_00330
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_04297: enoyl-CoA hydratase/isomerase family protein
 
Oceanobacter sp. RED65

Gene: RED65_05707: enoyl-CoA hydratase/isomerase family protein
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_2378: enoyl-CoA hydratase/isomerase family protein
 
Teredinibacter turnerae T7901

Gene: TERTU_2958: enoyl-CoA hydratase/isomerase family protein
 
Cellvibrio japonicus Ueda107

Gene: CJA_2410: enoyl-CoA hydratase/isomerase family protein
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -67
score = 5.83947
sequence = ATTCAAACGCGCGTTTAAAT

Gene: MED297_00330: enoyl-CoA hydratase/isomerase family protein
 
Alcanivorax borkumensis SK2
enoyl-CoA hydratase/isomerase family protein
 
CRON 6.
fadB
*
Hahella chejuensis KCTC 2396

Site:
position = -141
score = 5.86674
sequence = ATTCAAACGAGCGTATGAAT

Gene: HCH_04756: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Marinobacter aqueolei

Site:
position = -132
score = 5.85591
sequence = ATTCAAACGACTGTATGAAT

Gene: Maqu_1144: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Marinobacter sp. ELB17

Site:
position = -149
score = 5.70228
sequence = ATTCAAACGGCTGTATGAAT

Gene: MELB17_11445: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Oceanobacter sp. RED65

Site:
position = -138
score = 5.71311
sequence = ATTCAAACGGGCGTATGAAT

Gene: RED65_01305: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Oceanospirillum sp. MED92

Gene: MED92_08291: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1578: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Saccharophagus degradans 2-40

Site:
position = -90
score = 6.15283
sequence = ATTCAAACAAGCGTTTGAAT

Gene: Sde_1605: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Teredinibacter turnerae T7901

Gene: TERTU_1620: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -108
score = 5.96901
sequence = ATTCAAACGATTGTATGAAA

Gene: Csal_2393: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*2
Reinekea sp. MED297

Site:
position = -152
score = 6.0427
sequence = AATCAAACAATCGTTTGAAA

Site:
position = -139
score = 5.10644
sequence = TTTGAAACTGGTGTTTGATT

Gene: MED297_15730: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)

Gene: MED297_15739: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Alcanivorax borkumensis SK2

Gene: ABO_1652: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA
 
Hahella chejuensis KCTC 2396

Gene: HCH_04754: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Marinobacter aqueolei

Gene: Maqu_1145: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Marinobacter sp. ELB17

Gene: MELB17_11450: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Oceanobacter sp. RED65

Gene: RED65_01310: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Oceanospirillum sp. MED92

Gene: MED92_08296: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1579: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Saccharophagus degradans 2-40

Gene: Sde_1606: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Teredinibacter turnerae T7901

Gene: TERTU_1621: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Cellvibrio japonicus Ueda107

Gene: CJA_1693: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2392: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Reinekea sp. MED297

Gene: MED297_15744: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Alcanivorax borkumensis SK2

Gene: ABO_1653: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
CRON 7.
acdH3
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -101
score = 4.98895
sequence = AATCAAACGAACGCTTGACT

Site:
position = -61
score = 5.58832
sequence = TTTCAAACGCATGTTTGATG

Gene: Csal_2431: acyl-CoA dehydrogenase-like protein
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
acyl-CoA dehydrogenase-like protein
 
CRON 8.
Maqu_0515
 
Hahella chejuensis KCTC 2396
*
Marinobacter aqueolei

Site:
position = -91
score = 5.37482
sequence = ATTCAAACGCCCGTATGAAG

Gene: Maqu_0515: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Marinobacter sp. ELB17

Site:
position = -66
score = 5.61477
sequence = ATTAAAACAGTCGTATGAAT

Gene: MELB17_18674: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Oceanobacter sp. RED65

Gene: RED65_12124: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 9.
HCH_05787
*
Hahella chejuensis KCTC 2396

Site:
position = -71
score = 5.89939
sequence = TTTCAAACGAATGTTTTAAA

Site:
position = -84
score = 5.00037
sequence = CATAAAACGACTGTTTCAAA

Gene: HCH_05787: hypothetical protein
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
hypothetical protein
 
CRON 10.
fadD
 
Hahella chejuensis KCTC 2396

Gene: HCH_02646: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Marinobacter aqueolei

Gene: Maqu_1593: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Marinobacter sp. ELB17

Gene: MELB17_14136: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Oceanobacter sp. RED65

Gene: RED65_05369: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -249
score = 5.11499
sequence = TTTTAATCGTCTGTTTTAAT

Gene: Csal_1468: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Reinekea sp. MED297

Site:
position = -95
score = 5.66199
sequence = TATCAAACGACCGTTTTAAT

Gene: MED297_17502: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Alcanivorax borkumensis SK2
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 11.
scp
*
Hahella chejuensis KCTC 2396

Site:
position = -200
score = 5.47118
sequence = ATTCAAACAAGCGTTCGATT

Gene: HCH_02532: Sterol-binding domain protein
*
Marinobacter aqueolei

Site:
position = -158
score = 4.9691
sequence = ATTAAAACAAGCGTTCGATC

Gene: Maqu_1531: Sterol-binding domain protein
*
Marinobacter sp. ELB17

Site:
position = -108
score = 5.77073
sequence = ATTAAAACAATCGTTTGAAC

Gene: MELB17_13866: Sterol-binding domain protein
 
Oceanobacter sp. RED65

Gene: RED65_04510: Sterol-binding domain protein
 
Oceanospirillum sp. MED92

Gene: MED92_09256: Sterol-binding domain protein
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -59
score = 5.66644
sequence = TATGAAACATTTGTTTGAAA

Gene: Csal_1939: Sterol-binding domain protein
*
Reinekea sp. MED297

Site:
position = -112
score = 5.12073
sequence = TTTTATACGTCTGTTTCAAA

Site:
position = -99
score = 6.11381
sequence = TTTCAAACAATTGTTTGATT

Gene: MED297_16784: Sterol-binding domain protein
 
Alcanivorax borkumensis SK2
Sterol-binding domain protein
 
CRON 12.
etfB
*
Hahella chejuensis KCTC 2396

Site:
position = -402
score = 5.73683
sequence = AaaCAAACgttTGTTTGAAT

Gene: HCH_03950: Electron transfer flavoprotein, beta subunit
*
Marinobacter aqueolei

Site:
position = -172
score = 5.43305
sequence = AATCAAACAAACGTTTGTTT

Site:
position = -168
score = 5.70471
sequence = AAACAAACGTTTGTTTGAAA

Gene: Maqu_1471: Electron transfer flavoprotein, beta subunit
*
Marinobacter sp. ELB17

Site:
position = -202
score = 5.43499
sequence = AAACAAACGTTTGTTTTAAT

Gene: MELB17_13682: Electron transfer flavoprotein, beta subunit
 
Oceanobacter sp. RED65

Gene: RED65_01835: Electron transfer flavoprotein, beta subunit
 3
Oceanospirillum sp. MED92

Gene: MED92_08281: Electron transfer flavoprotein, beta subunit

Gene: MED92_06218: Electron transfer flavoprotein, beta subunit

Gene: MED92_13151: Electron transfer flavoprotein, beta subunit
 2
Marinomonas sp. MWYL1

Gene: Mmwyl1_3160: Electron transfer flavoprotein, beta subunit

Gene: Mmwyl1_3015: Electron transfer flavoprotein, beta subunit
 
Saccharophagus degradans 2-40

Gene: Sde_1998: Electron transfer flavoprotein, beta subunit
 
Teredinibacter turnerae T7901

Gene: TERTU_2137: Electron transfer flavoprotein, beta subunit
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -246
score = 5.72831
sequence = TTTTAAACGGTTGTTTGATT

Site:
position = -65
score = 4.9858
sequence = TATCAAACGCTTGAATGAAT

Gene: Csal_1613: Electron transfer flavoprotein, beta subunit
*
Reinekea sp. MED297

Site:
position = -205
score = 5.92085
sequence = ATTAAAACAACTGTTTGAAA

Gene: MED297_16319: Electron transfer flavoprotein, beta subunit
*
Alcanivorax borkumensis SK2

Site:
position = -251
score = 5.54336
sequence = TTTCAAACAAGTGTTTAGAT

Gene: ABO_1101: Electron transfer flavoprotein, beta subunit
Electron transfer flavoprotein, beta subunit
etfA
 
Hahella chejuensis KCTC 2396

Gene: HCH_03949: Electron transfer flavoprotein, alpha subunit
 
Marinobacter aqueolei

Gene: Maqu_1470: Electron transfer flavoprotein, alpha subunit
 
Marinobacter sp. ELB17

Gene: MELB17_13677: Electron transfer flavoprotein, alpha subunit
 
Oceanobacter sp. RED65

Gene: RED65_01830: Electron transfer flavoprotein, alpha subunit
 3
Oceanospirillum sp. MED92

Gene: MED92_08286: Electron transfer flavoprotein, alpha subunit

Gene: MED92_06223: Electron transfer flavoprotein, alpha subunit

Gene: MED92_13156: Electron transfer flavoprotein, alpha subunit
 2
Marinomonas sp. MWYL1

Gene: Mmwyl1_3159: Electron transfer flavoprotein, alpha subunit

Gene: Mmwyl1_3014: Electron transfer flavoprotein, alpha subunit
 
Saccharophagus degradans 2-40

Gene: Sde_1997: Electron transfer flavoprotein, alpha subunit
 
Teredinibacter turnerae T7901

Gene: TERTU_2138: Electron transfer flavoprotein, alpha subunit
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1614: Electron transfer flavoprotein, alpha subunit
 
Reinekea sp. MED297

Gene: MED297_16314: Electron transfer flavoprotein, alpha subunit
 
Alcanivorax borkumensis SK2

Gene: ABO_1102: Electron transfer flavoprotein, alpha subunit
Electron transfer flavoprotein, alpha subunit
Maqu_1467
 
Hahella chejuensis KCTC 2396

Gene: HCH_05374: putative saccharopine dehydrogenase
*
Marinobacter aqueolei

Site:
position = -31
score = 5.49938
sequence = ATTCATACATTCGTTTGAAC

Gene: Maqu_1467: putative saccharopine dehydrogenase
 
Marinobacter sp. ELB17

Gene: MELB17_13672: putative saccharopine dehydrogenase
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_19577: putative saccharopine dehydrogenase
 
Alcanivorax borkumensis SK2

Gene: ABO_0300: putative saccharopine dehydrogenase
putative saccharopine dehydrogenase
 
CRON 13.
acdH1
*
Hahella chejuensis KCTC 2396

Site:
position = -135
score = 5.28997
sequence = AAGCAAACGTATGTTTCAAA

Site:
position = -122
score = 5.92805
sequence = TTTCAAACACTTGTTTGATA

Gene: HCH_05361: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Marinobacter aqueolei

Site:
position = -115
score = 5.8341
sequence = TTTCAAACGAGTGTTTAATT

Gene: Maqu_2750: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Marinobacter sp. ELB17

Site:
position = -114
score = 6.0566
sequence = TTTCAAACAATCGTTTAAAA

Gene: MELB17_07014: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Oceanobacter sp. RED65

Site:
position = -122
score = 5.4929
sequence = TTGCAAACGTATGTTTCAAA

Site:
position = -109
score = 5.82548
sequence = TTTCAAACACTTGTTTGAAG

Gene: RED65_07784: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Oceanospirillum sp. MED92

Gene: MED92_08251: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1571: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Saccharophagus degradans 2-40

Gene: Sde_1885: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Teredinibacter turnerae T7901

Gene: TERTU_1889: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -122
score = 6.30705
sequence = TTTCAAACGATCGTTTGAAT

Gene: MED297_12452: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Alcanivorax borkumensis SK2
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 14.
etfD
*
Hahella chejuensis KCTC 2396

Site:
position = -242
score = 5.21802
sequence = AAACAAACGTTTGTTTGAGT

Site:
position = -246
score = 5.63103
sequence = ATTCAAACAAACGTTTGTTT

Gene: HCH_03954: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Marinobacter aqueolei

Site:
position = -170
score = 5.63598
sequence = TTTCAAACAAACGTTTGTTT

Site:
position = -166
score = 5.55848
sequence = AAACAAACGTTTGTTTGATT

Gene: Maqu_1472: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Marinobacter sp. ELB17

Site:
position = -191
score = 5.44201
sequence = ATTAAAACAAACGTTTGTTT

Gene: MELB17_13687: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Oceanobacter sp. RED65

Site:
position = -236
score = 6.02849
sequence = ATTCAAACGCGCGTTTGAAT

Gene: RED65_07029: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 2
Oceanospirillum sp. MED92

Gene: MED92_06213: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Gene: MED92_08416: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2259: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Saccharophagus degradans 2-40

Gene: Sde_1999: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Teredinibacter turnerae T7901

Gene: TERTU_2136: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Cellvibrio japonicus Ueda107

Gene: CJA_2608: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Chromohalobacter salexigens DSM 3043

Site:
position = -127
score = 5.70845
sequence = AATCAAACAACCGTTTAAAA

Gene: Csal_1612: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Reinekea sp. MED297

Site:
position = -157
score = 5.83668
sequence = TTTCAAACAGTTGTTTTAAT

Gene: MED297_16324: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Alcanivorax borkumensis SK2

Site:
position = -233
score = 5.36429
sequence = ATCTAAACACTTGTTTGAAA

Gene: ABO_1100: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
CRON 15.
psrA
*
Hahella chejuensis KCTC 2396

Site:
position = -41
score = 5.38569
sequence = TTTCAAACACTTGTTTGGAG

Site:
position = -54
score = 5.66157
sequence = TATCAAACGTATGTTTCAAA

Gene: HCH_02677: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Marinobacter aqueolei

Site:
position = -50
score = 5.40468
sequence = CTTCAAACGTATGTTTCAAA

Site:
position = -37
score = 5.34087
sequence = TTTCAAACAGACGTTTGCTA

Gene: Maqu_1938: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Marinobacter sp. ELB17

Site:
position = -63
score = 5.97238
sequence = TTTCAAACGTATGTTTAAAA

Site:
position = -50
score = 5.78335
sequence = TTTAAAACGTATGTTTAAAA

Gene: MELB17_17849: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Oceanobacter sp. RED65

Site:
position = -46
score = 4.80154
sequence = TTCAGAACGTATGTTTAAAA

Site:
position = -33
score = 6.08872
sequence = TTTAAAACAATCGTTTGAAT

Gene: RED65_00695: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Oceanospirillum sp. MED92

Gene: MED92_09266: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1789: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Teredinibacter turnerae T7901

Gene: TERTU_1940: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -36
score = 4.92101
sequence = TTTTAAACATTCGTTTATTC

Gene: Csal_2069: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Reinekea sp. MED297

Site:
position = -32
score = 6.08589
sequence = TTTAAAACGATCGTTTGAAA

Gene: MED297_15989: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Alcanivorax borkumensis SK2

Site:
position = -48
score = 4.873
sequence = GGGCAAACGTATGTTTGAAA

Site:
position = -35
score = 5.06399
sequence = TTTGAAACGTATGTTTCGAA

Gene: ABO_1016: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
CRON 16.
MED297_20722
 
Hahella chejuensis KCTC 2396

Gene: HCH_05409: TesB-like acyl-CoA thioesterase 1
 
Marinobacter aqueolei

Gene: Maqu_2429: TesB-like acyl-CoA thioesterase 1
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_11014: TesB-like acyl-CoA thioesterase 1
 
Oceanospirillum sp. MED92

Gene: MED92_00265: TesB-like acyl-CoA thioesterase 1
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -55
score = 6.15688
sequence = ATTCAAACGACCGTTTGAAT

Gene: MED297_20722: TesB-like acyl-CoA thioesterase 1
 
Alcanivorax borkumensis SK2

Gene: ABO_1111: TesB-like acyl-CoA thioesterase 1
TesB-like acyl-CoA thioesterase 1
 
CRON 17.
acdH2
 
Hahella chejuensis KCTC 2396

Gene: HCH_05360: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Marinobacter aqueolei

Gene: Maqu_2749: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Marinobacter sp. ELB17

Gene: MELB17_07019: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Oceanobacter sp. RED65

Gene: RED65_07779: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -162
score = 5.71368
sequence = ATTTAAACGTTTGTTTTAAT

Gene: Sde_3132: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 18.
fadH
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_2848: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_00020: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*2
Chromohalobacter salexigens DSM 3043

Gene: Csal_1200: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)

Site:
position = -61
score = 5.29259
sequence = GTTCATACAGTTGTTTGAAA

Gene: Csal_0879: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1705: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD