Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36 9 6
Aeromonas hydrophila subsp. hydrophila ATCC 7966 7 4
Aeromonas salmonicida subsp. salmonicida A449 7 4
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fadB
 
Psychromonas ingrahamii 37

Gene: Ping_2604: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08305: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Moritella sp. PE36

Site:
position = -135
score = 5.5612
sequence = AGTTAAACAGTCGTTTAAAA

Site:
position = -122
score = 4.77819
sequence = TTTAAAATAAGTGTTGAAAT

Gene: PE36_15295: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -123
score = 5.13755
sequence = TGTTAAACGAATGTTTTAAA

Site:
position = -110
score = 4.83827
sequence = TTTTAAATAGGTGTTGAAAT

Gene: AHA_0139: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -123
score = 5.18814
sequence = TGTTAAACAAATGTTTTAAA

Site:
position = -110
score = 4.76722
sequence = TTTTAAATAGGTGTTGAAAA

Gene: ASA_4250: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Tolumonas auensis DSM 9187
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_15300: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0138: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4251: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Tolumonas auensis DSM 9187
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
CRON 2.
PE36_15065
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -55
score = 5.66225
sequence = ATTCAAACATATGTTTGAAA

Gene: PE36_15065: acetyl-CoA acetyltransferase
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
acetyl-CoA acetyltransferase
 
CRON 3.
fadI
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*2
Moritella sp. PE36

Site:
position = -96
score = 5.10759
sequence = TTTCAAACTAATGTTTGAAT

Gene: PE36_17987: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)

Gene: PE36_12372: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -100
score = 4.82321
sequence = TTTCAATCAGCCGTATGAAA

Gene: AHA_2153: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -89
score = 4.82321
sequence = TTTCAATCAGCCGTATGAAA

Gene: ASA_2146: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Tolumonas auensis DSM 9187
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadJ
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_17982: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2154: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2145: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Tolumonas auensis DSM 9187
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
CRON 4.
fadD2
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -138
score = 5.265
sequence = AATCATACGACTGTTTAAAT

Gene: PE36_17450: long-chain-fatty-acid--CoA ligase
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
long-chain-fatty-acid--CoA ligase
 
CRON 5.
fadH
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -132
score = 4.35216
sequence = GATTAAAATAGCGTTTGAAA

Site:
position = -119
score = 4.31587
sequence = TTTGAAATGAACGATTAAAT

Gene: PE36_13067: 2,4-dienoyl-CoA reductase (EC 1.3.1.34)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -182
score = 5.01103
sequence = GTCCAAACATTTGTTTGAAA

Gene: AHA_3357: 2,4-dienoyl-CoA reductase (EC 1.3.1.34)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -81
score = 5.01103
sequence = GTCCAAACATTTGTTTGAAA

Gene: ASA_0950: 2,4-dienoyl-CoA reductase (EC 1.3.1.34)
 
Tolumonas auensis DSM 9187
2,4-dienoyl-CoA reductase (EC 1.3.1.34)
 
CRON 6.
psrA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -81
score = 5.31882
sequence = TTTCAAACATTTGTTTACAT

Site:
position = -30
score = 5.58538
sequence = TTTAAAACGTTCGTTTAAAA

Gene: PE36_04678: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -30
score = 5.38944
sequence = TTTTAAACATTCGTTTAAGT

Gene: AHA_1345: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -19
score = 5.14055
sequence = TTTTAAACATTCGTTTTAAG

Gene: ASA_1317: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Tolumonas auensis DSM 9187
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE1
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_04673: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1346: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1318: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Tolumonas auensis DSM 9187
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD