Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype' 4 3
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H 10 8
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145 8 6
Idiomarina loihiensis L2TR 9 7
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fadB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0201: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -147
score = 5.55519
sequence = ATTGAAACGCTTGTTTGATT

Gene: MADE_03736: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100011184: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Colwellia psychrerythraea 34H

Site:
position = -163
score = 5.61645
sequence = TTTAAAACACTTGTTTTAAA

Gene: CPS_0393: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Alteromonadales bacterium TW-7

Gene: ATW7_16353: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0011: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_05090: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Idiomarina baltica OS145

Site:
position = -132
score = 5.79549
sequence = ATTCAAACGCATGTTTAAAT

Gene: OS145_03250: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Idiomarina loihiensis L2TR

Site:
position = -133
score = 5.79549
sequence = ATTCAAACGCATGTTTAAAT

Gene: IL0011: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0202: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03737: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100011179: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Colwellia psychrerythraea 34H

Gene: CPS_0392: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 2
Alteromonadales bacterium TW-7

Gene: ATW7_16348: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)

Gene: ATW7_16343: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa0010: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_05095: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Idiomarina baltica OS145

Gene: OS145_03255: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Idiomarina loihiensis L2TR

Gene: IL0010: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
CRON 2.
acdH
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -66
score = 5.73406
sequence = ATTCAAACAAGTGTTTTAAT

Gene: CPS_4476: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -62
score = 5.7348
sequence = AATTAAACGCCTGTTTGAAA

Gene: OS145_03332: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Idiomarina loihiensis L2TR

Site:
position = -62
score = 5.52236
sequence = GTTTAAACAAGCGTTTAAAT

Gene: IL1963: Acyl-CoA dehydrogenase (EC 1.3.99.3)
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 3.
psrA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01897: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -149
score = 5.37325
sequence = TTTTAAACAGGTGTTTAAAC

Gene: CPS_1586: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -35
score = 5.70119
sequence = AATTAAACGCATGTTTAAAA

Gene: OS145_12684: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Idiomarina loihiensis L2TR

Site:
position = -38
score = 5.32875
sequence = GATTAAACGCATGTTTAAAT

Gene: IL0918: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE1
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_08731: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1920: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_18245: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Idiomarina baltica OS145

Gene: OS145_12689: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Idiomarina loihiensis L2TR

Gene: IL0917: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
CRON 4.
fadH1
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2400: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03303: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100003019: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Colwellia psychrerythraea 34H

Gene: CPS_0925: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Alteromonadales bacterium TW-7

Gene: ATW7_07132: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1410: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_19952: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Idiomarina baltica OS145

Site:
position = -35
score = 5.67918
sequence = AATTAAACGCCCGTTTAAAA

Gene: OS145_10515: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Idiomarina loihiensis L2TR

Site:
position = -104
score = 5.72977
sequence = AATTAAACACCCGTTTAAAA

Gene: IL1748: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
CRON 5.
fadE2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2492: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02152: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006812: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Colwellia psychrerythraea 34H

Gene: CPS_2265: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Alteromonadales bacterium TW-7

Gene: ATW7_08866: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1952: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_22672: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Idiomarina baltica OS145

Site:
position = -95
score = 5.33374
sequence = ATTCAAACAGGTGTTCAAAT

Gene: OS145_01812: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
*
Idiomarina loihiensis L2TR

Site:
position = -97
score = 5.0343
sequence = ATTCAAACGCCCGTTCAATT

Gene: IL1665: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
CRON 6.
ldh
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2995: Leucine dehydrogenase (EC 1.4.1.9)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02824: Leucine dehydrogenase (EC 1.4.1.9)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_2904: Leucine dehydrogenase (EC 1.4.1.9)
 
Alteromonadales bacterium TW-7

Gene: ATW7_06658: Leucine dehydrogenase (EC 1.4.1.9)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1167: Leucine dehydrogenase (EC 1.4.1.9)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_18100: Leucine dehydrogenase (EC 1.4.1.9)
*
Idiomarina baltica OS145

Site:
position = -109
score = 5.08455
sequence = TGCTAAACACCCGTTTGAAT

Gene: OS145_06047: Leucine dehydrogenase (EC 1.4.1.9)
*
Idiomarina loihiensis L2TR

Site:
position = -110
score = 5.00263
sequence = TGATAAACGCCCGTTTAAAT

Gene: IL1314: Leucine dehydrogenase (EC 1.4.1.9)
Leucine dehydrogenase (EC 1.4.1.9)
 
CRON 7.
fadD1
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2804: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01137: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -133
score = 5.88896
sequence = ATTAAAACAAGCGTTTAAAT

Gene: CPS_1189: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Alteromonadales bacterium TW-7

Gene: ATW7_00340: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0502: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02221: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Idiomarina baltica OS145

Gene: OS145_10285: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Idiomarina loihiensis L2TR

Gene: IL1827: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 8.
MADE_01742
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -32
score = 5.92979
sequence = ATTAAAACACTTGTTTGAAA

Gene: MADE_01742: probable acyl-CoA dehydrogenase
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100008221: probable acyl-CoA dehydrogenase
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
probable acyl-CoA dehydrogenase
 
CRON 9.
IL0656
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2935: putative acyl-CoA thioesterase, TesB family
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02424: putative acyl-CoA thioesterase, TesB family
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006927: putative acyl-CoA thioesterase, TesB family
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_02822: putative acyl-CoA thioesterase, TesB family
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0355: putative acyl-CoA thioesterase, TesB family
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02881: putative acyl-CoA thioesterase, TesB family
 
Idiomarina baltica OS145

Gene: OS145_06779: putative acyl-CoA thioesterase, TesB family
*
Idiomarina loihiensis L2TR

Site:
position = -30
score = 5.70491
sequence = AATCAAACAGTCGTTTAAAT

Gene: IL0656: putative acyl-CoA thioesterase, TesB family
putative acyl-CoA thioesterase, TesB family
 
CRON 10.
acdH2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1918: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02316: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007882: Acyl-CoA dehydrogenase (EC 1.3.99.3)
*
Colwellia psychrerythraea 34H

Site:
position = -80
score = 5.65963
sequence = AATCAAACACCTGTTTGAAA

Gene: CPS_1177: Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Acyl-CoA dehydrogenase (EC 1.3.99.3)
 
CRON 11.
etfD
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2147: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00995: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006517: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
*
Colwellia psychrerythraea 34H

Site:
position = -99
score = 5.65128
sequence = TATCAAACACTTGTTTGAAT

Site:
position = -80
score = 5.31557
sequence = TATCAAACGCACGTTTGAAA

Gene: CPS_3686: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Alteromonadales bacterium TW-7

Gene: ATW7_13183: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1619: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_19430: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Idiomarina baltica OS145

Gene: OS145_12869: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
Idiomarina loihiensis L2TR

Gene: IL0881: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
 
CRON 12.
etfB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2146: Electron transfer flavoprotein, beta subunit
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00996: Electron transfer flavoprotein, beta subunit
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006522: Electron transfer flavoprotein, beta subunit
*
Colwellia psychrerythraea 34H

Site:
position = -202
score = 5.31187
sequence = TTTCAAACGTGCGTTTGATA

Site:
position = -183
score = 5.65694
sequence = ATTCAAACAAGTGTTTGATA

Gene: CPS_3687: Electron transfer flavoprotein, beta subunit
 
Alteromonadales bacterium TW-7

Gene: ATW7_13178: Electron transfer flavoprotein, beta subunit
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1618: Electron transfer flavoprotein, beta subunit
 
Pseudoalteromonas tunicata D2

Gene: PTD2_19467: Electron transfer flavoprotein, beta subunit
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Electron transfer flavoprotein, beta subunit
etfA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2145: Electron transfer flavoprotein, alpha subunit
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00997: Electron transfer flavoprotein, alpha subunit
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006527: Electron transfer flavoprotein, alpha subunit
 
Colwellia psychrerythraea 34H

Gene: CPS_3688: Electron transfer flavoprotein, alpha subunit
 
Alteromonadales bacterium TW-7

Gene: ATW7_13173: Electron transfer flavoprotein, alpha subunit
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1617: Electron transfer flavoprotein, alpha subunit
 
Pseudoalteromonas tunicata D2

Gene: PTD2_19472: Electron transfer flavoprotein, alpha subunit
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Electron transfer flavoprotein, alpha subunit
 
CRON 13.
fadD2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0998: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -110
score = 5.62832
sequence = ATGTAAACGCTTGTTTAAAA

Gene: MADE_01022: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007842: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 14.
SO2935
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2183: oxidoreductase, short-chain dehydrogenase/reductase family
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01893: oxidoreductase, short-chain dehydrogenase/reductase family
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100006892: oxidoreductase, short-chain dehydrogenase/reductase family
*
Colwellia psychrerythraea 34H

Site:
position = -186
score = 5.09762
sequence = ATTCAAACTAATGTTTTAAT

Gene: CPS_1191: oxidoreductase, short-chain dehydrogenase/reductase family
 
Alteromonadales bacterium TW-7

Gene: ATW7_07484: oxidoreductase, short-chain dehydrogenase/reductase family
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1343: oxidoreductase, short-chain dehydrogenase/reductase family
 
Pseudoalteromonas tunicata D2

Gene: PTD2_18015: oxidoreductase, short-chain dehydrogenase/reductase family
 
Idiomarina baltica OS145

Gene: OS145_11996: oxidoreductase, short-chain dehydrogenase/reductase family
 
Idiomarina loihiensis L2TR

Gene: IL1040: oxidoreductase, short-chain dehydrogenase/reductase family
oxidoreductase, short-chain dehydrogenase/reductase family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD