Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 9 6
Vibrio vulnificus CMCP6 10 6
Vibrio harveyi ATCC BAA-1116 9 6
Vibrio parahaemolyticus RIMD 2210633 9 6
Vibrio shilonii AK1 8 5
Vibrio splendidus LGP32 8 5
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14 9 6
Photobacterium profundum SS9 8 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fadD2
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2341: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio vulnificus CMCP6

Gene: VV1_1742: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03363: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2425: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio shilonii AK1

Gene: VSAK1_10793: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio splendidus LGP32

Gene: VS_2450: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio fischeri ES114

Gene: VF_0533: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0631: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Vibrio angustum S14

Site:
position = -215
score = 5.2835
sequence = TTTCATACAAGTGTTTAAAA

Gene: VAS14_14924: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Photobacterium profundum SS9

Site:
position = -179
score = 5.38629
sequence = AATTATACACTCGTTTAAAA

Gene: PBPRB0510: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 2.
fadL2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_03753: Long-chain fatty acid transport protein
*
Photobacterium profundum SS9

Site:
position = -355
score = 5.52344
sequence = TTTAAAACGGTTGTTTTAAA

Site:
position = -373
score = 5.05201
sequence = TTCTAAACGCCCGTTTTATT

Gene: PBPRA2573: Long-chain fatty acid transport protein
Long-chain fatty acid transport protein
 
CRON 3.
fadH
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -81
score = 5.55596
sequence = ATGTAAACACTTGTTTGATT

Gene: VC1993: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Vibrio vulnificus CMCP6

Site:
position = -77
score = 5.37321
sequence = ATGTAAACGCATGTTTGATT

Gene: VV1_3132: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -78
score = 4.88467
sequence = ATGTAAACGGCTGTTTGATC

Gene: VIBHAR_03043: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -87
score = 5.48369
sequence = ATGTAAACACCTGTTTGATT

Gene: VP2151: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Vibrio shilonii AK1

Site:
position = -82
score = 4.9119
sequence = ATGTAAACGCTAGTTTGATT

Gene: VSAK1_03494: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Vibrio splendidus LGP32

Site:
position = -72
score = 5.12467
sequence = ATGTAAACGGTTGTTTGAAC

Gene: VS_0938: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Vibrio fischeri ES114

Gene: VF_1642: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2156: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Vibrio angustum S14

Site:
position = -76
score = 5.49486
sequence = ATGTAAACAAATGTTTGAAA

Gene: VAS14_05978: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
*
Photobacterium profundum SS9

Site:
position = -76
score = 5.49486
sequence = ATGTAAACAAATGTTTGAAA

Gene: PBPRA2594: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
 
CRON 4.
fadB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -136
score = 5.53384
sequence = TGTTAAACACTTGTTTAAAA

Gene: VC2758: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Vibrio vulnificus CMCP6

Site:
position = -169
score = 5.53384
sequence = TGTTAAACACTTGTTTAAAA

Gene: VV1_0981: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -186
score = 5.53384
sequence = TGTTAAACACTTGTTTAAAA

Gene: VIBHAR_00460: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -175
score = 5.53384
sequence = TGTTAAACACTTGTTTAAAA

Gene: VP0030: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Vibrio shilonii AK1

Site:
position = -136
score = 5.49142
sequence = TGTTAAACAGTTGTTTAAAA

Gene: VSAK1_12702: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Vibrio splendidus LGP32

Site:
position = -147
score = 5.50823
sequence = TGTTAAACAATTGTTTAAAA

Gene: VS_0041: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio fischeri ES114

Gene: VF_0025: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2974: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Vibrio angustum S14

Site:
position = -132
score = 5.44712
sequence = TGTTAAACAAATGTTTAAAT

Gene: VAS14_22297: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
*
Photobacterium profundum SS9

Site:
position = -115
score = 4.85508
sequence = TTTTAAATAAGTGTTGAAAT

Site:
position = -128
score = 5.02849
sequence = GGTTAAACAATTGTTTTAAA

Gene: PBPRA0064: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2759: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio vulnificus CMCP6

Gene: VV1_0982: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00459: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0029: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio shilonii AK1

Gene: VSAK1_12697: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio splendidus LGP32

Gene: VS_0040: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio fischeri ES114

Gene: VF_0024: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2973: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio angustum S14

Gene: VAS14_22302: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Photobacterium profundum SS9

Gene: PBPRA0063: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
CRON 5.
fadI
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 69
score = 5.74472
sequence = ATTtAAACggcTGTTTGAtT

Gene: VC1046: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Vibrio vulnificus CMCP6

Site:
position = -78
score = 5.6562
sequence = ATTTAAACGCATGTTTGATA

Gene: VV1_1975: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -78
score = 5.6562
sequence = ATTTAAACGCATGTTTGATA

Gene: VIBHAR_03121: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -78
score = 5.5743
sequence = ATTTAAACGCACGTTTGATA

Gene: VP2209: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Vibrio shilonii AK1

Site:
position = -74
score = 5.39586
sequence = TATTAAACGACTGTTTTAAA

Gene: VSAK1_03244: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Vibrio splendidus LGP32

Site:
position = -78
score = 5.78714
sequence = ATTTAAACGCCTGTTTGATT

Gene: VS_0864: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio fischeri ES114

Gene: VF_1811: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2268: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Vibrio angustum S14

Site:
position = -114
score = 5.42472
sequence = ATTTAAACACTTGATTGAAT

Gene: VAS14_17336: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
*
Photobacterium profundum SS9

Site:
position = -135
score = 5.69427
sequence = AATAAAACATTTGTTTGAAA

Gene: PBPRA0961: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadJ
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1047: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio vulnificus CMCP6

Gene: VV1_1976: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03120: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2208: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio shilonii AK1

Gene: VSAK1_03249: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio splendidus LGP32

Gene: VS_0865: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio fischeri ES114

Gene: VF_1810: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_17341: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
Photobacterium profundum SS9

Gene: PBPRA0962: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
 
CRON 6.
psrA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 16
score = 5.51909
sequence = TTTCAAACAGTTGTTTGATA

Gene: VC1741: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Vibrio vulnificus CMCP6

Site:
position = -32
score = 5.51909
sequence = TTTCAAACAGTTGTTTGATA

Gene: VV1_2832: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -32
score = 5.54536
sequence = TTTCAAACAGTTGTTTAATA

Gene: VIBHAR_02639: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -32
score = 5.54536
sequence = TTTCAAACAGTTGTTTAATA

Gene: VP1229: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Vibrio shilonii AK1

Site:
position = -32
score = 5.59604
sequence = ATTCAAACATGTGTTTGATA

Gene: VSAK1_06350: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
*
Vibrio splendidus LGP32

Site:
position = -23
score = 5.54536
sequence = TTTCAAACAGTTGTTTAATA

Gene: VS_1841: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -33
score = 5.74808
sequence = ATTTAAACATGTGTTTAATA

Gene: VAS14_00861: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
 
Photobacterium profundum SS9
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1740: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 2
Vibrio vulnificus CMCP6

Gene: VV1_2831: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)

Gene: VV1_2830: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02638: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1230: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Vibrio shilonii AK1

Gene: VSAK1_06345: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Vibrio splendidus LGP32

Gene: VS_1840: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_00866: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
Photobacterium profundum SS9

Gene: PBPRA2424: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
 
CRON 7.
fadD
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -130
score = 5.55595
sequence = ATTTAAACAAGTGTTTGAGA

Gene: VC1985: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Vibrio vulnificus CMCP6

Site:
position = -127
score = 5.55595
sequence = ATTTAAACAAGTGTTTGAGA

Gene: VV1_0136: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -112
score = 5.55595
sequence = ATTTAAACAAGTGTTTGAGA

Gene: VIBHAR_01379: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -112
score = 5.55595
sequence = ATTTAAACAAGTGTTTGAGA

Gene: VP0870: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Vibrio shilonii AK1

Site:
position = -174
score = 5.478
sequence = AATTAAACAAGTGTTTGAGT

Gene: VSAK1_09078: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
*
Vibrio splendidus LGP32

Site:
position = -112
score = 5.121
sequence = ATTTAAACAAGTGTTTGAGC

Gene: VS_2220: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio fischeri ES114

Gene: VF_1708: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -88
score = 5.46193
sequence = ATATAAACGCTTGTTTGATT

Gene: VAS14_17861: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
Photobacterium profundum SS9

Gene: PBPRA1075: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
 
CRON 8.
SO3908
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_01321: Enoyl-CoA hydratase (EC 4.2.1.17)
*
Photobacterium profundum SS9

Site:
position = -69
score = 5.46104
sequence = AGTTAAACGTATGTTTGAAT

Gene: PBPRA2339: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 9.
mdh
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -299
score = 5.70953
sequence = ATTTAAACACTTGTTTAAGT

Gene: VC0734: Malate synthase (EC 2.3.3.9)
*
Vibrio vulnificus CMCP6

Site:
position = -270
score = 5.17057
sequence = AATCAAGCACTTGTTTGAAA

Gene: VV1_0450: Malate synthase (EC 2.3.3.9)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -348
score = 5.56249
sequence = ATTCATACACTTGTTTAAAT

Site:
position = -265
score = 5.56418
sequence = AATCAAACACTTGTTTGATA

Gene: VIBHAR_01041: Malate synthase (EC 2.3.3.9)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -348
score = 5.23123
sequence = ATTCATACACCTGTTTTAAA

Gene: VP0583: Malate synthase (EC 2.3.3.9)
 
Vibrio shilonii AK1

Gene: VSAK1_24895: Malate synthase (EC 2.3.3.9)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114

Gene: VF_1973: Malate synthase (EC 2.3.3.9)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2439: Malate synthase (EC 2.3.3.9)
 
Vibrio angustum S14

Gene: VAS14_06773: Malate synthase (EC 2.3.3.9)
 2
Photobacterium profundum SS9

Gene: PBPRA0737: Malate synthase (EC 2.3.3.9)

Gene: PBPRA2276: Malate synthase (EC 2.3.3.9)
Malate synthase (EC 2.3.3.9)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD