Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PuuR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: XRE
Regulation mode:
Biological process: Spermidine biosynthesis
Effector: Putrescine
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Fervidobacterium nodosum Rt17-B1 3 1
Petrotoga mobilis SJ95
Thermosipho africanus TCF52B 7 1
Thermosipho melanesiensis BI429 7 1
Thermotoga lettingae TMO 3 1
Thermotoga maritima MSB8 3 1
Thermotoga naphthophila RKU-10 3 1
Thermotoga neapolitana DSM 4359 3 1
Thermotoga petrophila RKU-1 3 1
Thermotoga sp. RQ2 3 1
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
puuR
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1325: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
 
Petrotoga mobilis SJ95

Gene: Pmob_1419: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermosipho africanus TCF52B

Site:
position = -59
score = 4.49399
sequence = ATGTTCTGTATCATAGACAT

Site:
position = -36
score = 5.6224
sequence = TTGTTCAGTATTATAGACAT

Gene: THA_1405: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermosipho melanesiensis BI429

Site:
position = -32
score = 5.48714
sequence = TTGTTTAGTATTATAGACAT

Gene: Tmel_0572: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermotoga lettingae TMO

Site:
position = -220
score = 5.1977
sequence = TTGTTGAGGATAATTGACAA

Site:
position = -62
score = 5.47712
sequence = GTGATCAATATACTGGACAA

Gene: Tlet_0752: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermotoga maritima MSB8

Site:
position = -58
score = 4.76475
sequence = ATGTCTGTGATACTGAACAA

Site:
position = -36
score = 6.8092
sequence = TTGTCAACTATAGTGGACAA

Gene: TM0656: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermotoga naphthophila RKU-10

Site:
position = -58
score = 4.76475
sequence = ATGTCTGTGATACTGAACAA

Site:
position = -36
score = 6.8092
sequence = TTGTCAACTATAGTGGACAA

Gene: Tnap_0452: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermotoga neapolitana DSM 4359

Site:
position = -22
score = 4.76475
sequence = ATGTCTGTGATACTGAACAA

Site:
position = 0
score = 6.42085
sequence = TTGTCAACTATAGTGGTCAA

Gene: CTN_0001: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermotoga petrophila RKU-1

Site:
position = -22
score = 4.76475
sequence = ATGTCTGTGATACTGAACAA

Site:
position = 0
score = 6.8092
sequence = TTGTCAACTATAGTGGACAA

Gene: Tpet_0275: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
*
Thermotoga sp. RQ2

Site:
position = -58
score = 4.76475
sequence = ATGTCTGTGATACTGAACAA

Site:
position = -36
score = 6.8092
sequence = TTGTCAACTATAGTGGACAA

Gene: TRQ2_0273: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
 
Thermotogales bacterium TBF 19.5.1
Predicted transcriptional regulator of spermidine biosynthesis, Xre family
speD
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -134
score = 4.90103
sequence = TTGTTCACTTAAGTAAACAT

Gene: Fnod_1327: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Petrotoga mobilis SJ95

Gene: Pmob_1418: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermosipho africanus TCF52B

Gene: THA_1404: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermosipho melanesiensis BI429

Gene: Tmel_0571: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotoga lettingae TMO

Gene: Tlet_0753: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotoga maritima MSB8

Gene: TM0655: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0451: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0002: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotoga petrophila RKU-1

Gene: Tpet_0276: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotoga sp. RQ2

Gene: TRQ2_0274: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0270: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
speE
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1326: Spermidine synthase (EC 2.5.1.16)
 
Petrotoga mobilis SJ95

Gene: Pmob_1417: Spermidine synthase (EC 2.5.1.16)
 
Thermosipho africanus TCF52B

Gene: THA_1403: Spermidine synthase (EC 2.5.1.16)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0570: Spermidine synthase (EC 2.5.1.16)
 
Thermotoga lettingae TMO

Gene: Tlet_0754: Spermidine synthase (EC 2.5.1.16)
 
Thermotoga maritima MSB8

Gene: TM0654: Spermidine synthase (EC 2.5.1.16)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0450: Spermidine synthase (EC 2.5.1.16)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0003: Spermidine synthase (EC 2.5.1.16)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0277: Spermidine synthase (EC 2.5.1.16)
 
Thermotoga sp. RQ2

Gene: TRQ2_0275: Spermidine synthase (EC 2.5.1.16)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0271: Spermidine synthase (EC 2.5.1.16)
Spermidine synthase (EC 2.5.1.16)
potF
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1364: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Petrotoga mobilis SJ95
 
Thermosipho africanus TCF52B

Gene: THA_1402: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0569: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermotoga lettingae TMO
 
Thermotoga maritima MSB8

Gene: TM1375: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1428: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1216: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1408: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermotoga sp. RQ2

Gene: TRQ2_1454: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
 
Thermotogales bacterium TBF 19.5.1
Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
potA
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0370: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Petrotoga mobilis SJ95
 
Thermosipho africanus TCF52B

Gene: THA_1401: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0568: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermotoga lettingae TMO
 
Thermotoga maritima MSB8

Gene: TM1376: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1427: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1215: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1407: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermotoga sp. RQ2

Gene: TRQ2_1453: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
 
Thermotogales bacterium TBF 19.5.1
Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
potB
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0371: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Petrotoga mobilis SJ95
 
Thermosipho africanus TCF52B

Gene: THA_1400: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0567: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermotoga lettingae TMO
 
Thermotoga maritima MSB8

Gene: TM1377: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1426: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1214: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1406: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermotoga sp. RQ2

Gene: TRQ2_1452: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
 
Thermotogales bacterium TBF 19.5.1
Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
potC
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0372: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Petrotoga mobilis SJ95
 
Thermosipho africanus TCF52B

Gene: THA_1399: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0566: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermotoga lettingae TMO
 
Thermotoga maritima MSB8

Gene: TM1378: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1425: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1213: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1405: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermotoga sp. RQ2

Gene: TRQ2_1451: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
 
Thermotogales bacterium TBF 19.5.1
Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD