Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Rex - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692 34 10
Desulfomicrobium baculatum DSM 4028 31 9
Desulfovibrio desulfuricans G20 52 18
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 31 8
Desulfovibrio magneticus RS-1 32 9
Desulfovibrio piger ATCC 29098 16 6
Desulfovibrio salexigens DSM 2638 37 12
Desulfovibrio vulgaris Hildenborough 55 14
Desulfovibrio vulgaris str. Miyazaki F 33 11
Lawsonia intracellularis PHE/MN1-00 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Dde_0552
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -33
score = 5.27041
sequence = CTTGGGAAATTTTGCACAAC

Gene: Dde_0552: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: null: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2457: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
 
CRON 2.
dhcA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1961: Decaheme cytochrome c associated with Rnf complex
*
Desulfovibrio desulfuricans G20

Site:
position = -226
score = 4.41555
sequence = TATGTGAAAAATTTAATTAG

Gene: Dde_0580: Decaheme cytochrome c associated with Rnf complex
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -214
score = 4.57798
sequence = ACTGTGAAAAATATCACCAA

Gene: Ddes_1237: Decaheme cytochrome c associated with Rnf complex
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01994: Decaheme cytochrome c associated with Rnf complex
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_0919: Decaheme cytochrome c associated with Rnf complex

Gene: Desal_1741: Decaheme cytochrome c associated with Rnf complex
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -127
score = 4.01208
sequence = CTTGTGAAATAATGTTCTTT

Gene: DVU2791: Decaheme cytochrome c associated with Rnf complex
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Decaheme cytochrome c associated with Rnf complex
rnfC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0528: Electron transport complex protein RnfC
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1960: Electron transport complex protein RnfC
 
Desulfovibrio desulfuricans G20

Gene: Dde_0581: Electron transport complex protein RnfC
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1238: Electron transport complex protein RnfC
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01995: Electron transport complex protein RnfC
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_1740: Electron transport complex protein RnfC

Gene: Desal_0920: Electron transport complex protein RnfC
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2792: Electron transport complex protein RnfC
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Electron transport complex protein RnfC
rnfD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0529: Electron transport complex protein RnfD
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1959: Electron transport complex protein RnfD
 
Desulfovibrio desulfuricans G20

Gene: Dde_0582: Electron transport complex protein RnfD
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1239: Electron transport complex protein RnfD
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01996: Electron transport complex protein RnfD
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_0921: Electron transport complex protein RnfD

Gene: Desal_1739: Electron transport complex protein RnfD
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2793: Electron transport complex protein RnfD
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Electron transport complex protein RnfD
rnfG
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0530: Electron transport complex protein RnfG
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1958: Electron transport complex protein RnfG
 
Desulfovibrio desulfuricans G20

Gene: Dde_0583: Electron transport complex protein RnfG
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1240: Electron transport complex protein RnfG
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01997: Electron transport complex protein RnfG
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_0922: Electron transport complex protein RnfG

Gene: Desal_1738: Electron transport complex protein RnfG
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2794: Electron transport complex protein RnfG
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Electron transport complex protein RnfG
rnfE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0531: Electron transport complex protein RnfE
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1957: Electron transport complex protein RnfE
 
Desulfovibrio desulfuricans G20

Gene: Dde_0584: Electron transport complex protein RnfE
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1241: Electron transport complex protein RnfE
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01998: Electron transport complex protein RnfE
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_0923: Electron transport complex protein RnfE

Gene: Desal_1737: Electron transport complex protein RnfE
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2795: Electron transport complex protein RnfE
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Electron transport complex protein RnfE
rnfA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0532: Electron transport complex protein RnfA
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1956: Electron transport complex protein RnfA
 
Desulfovibrio desulfuricans G20

Gene: Dde_0585: Electron transport complex protein RnfA
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1242: Electron transport complex protein RnfA
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01999: Electron transport complex protein RnfA
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_0924: Electron transport complex protein RnfA

Gene: Desal_1736: Electron transport complex protein RnfA
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2796: Electron transport complex protein RnfA
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Electron transport complex protein RnfA
rnfB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0533: Electron transport complex protein RnfB
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1955: Electron transport complex protein RnfB
 
Desulfovibrio desulfuricans G20

Gene: Dde_0586: Electron transport complex protein RnfB
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1243: Electron transport complex protein RnfB
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02000: Electron transport complex protein RnfB
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2797: Electron transport complex protein RnfB
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Electron transport complex protein RnfB
DVU2798
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0536: ApbE family lipoprotein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1954: ApbE family lipoprotein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0587: ApbE family lipoprotein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1244: ApbE family lipoprotein
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02001: ApbE family lipoprotein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0926: ApbE family lipoprotein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2798: ApbE family lipoprotein
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
ApbE family lipoprotein
 
CRON 3.
atpI1
*
Desulfohalobium retbaense DSM 5692

Site:
position = -11
score = 4.64444
sequence = CTTGTGAATGAATGCACGAA

Gene: Dret_2089: ATP synthase protein I
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -56
score = 5.14293
sequence = TTTGTGATTTATTGCACGAA

Gene: Dbac_2797: ATP synthase protein I
*
Desulfovibrio desulfuricans G20

Site:
position = -68
score = 4.12426
sequence = CTTGTGAAGGAATGCACGAA

Site:
position = -151
score = 4.75327
sequence = CTTGTGAAAAATTTCTAAAA

Gene: Dde_2698: ATP synthase protein I
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2252: ATP synthase protein I
*
Desulfovibrio magneticus RS-1

Site:
position = -76
score = 4.35558
sequence = CTTGTGAACTTGTGCACGAG

Gene: DMR_42140: ATP synthase protein I
*
Desulfovibrio piger ATCC 29098

Site:
position = -11
score = 4.67558
sequence = ATTGTGATAATTTGTACATT

Gene: DESPIG_02071: ATP synthase protein I
*
Desulfovibrio salexigens DSM 2638

Site:
position = -74
score = 4.11452
sequence = CTTGTGAAGGTTTGCGCAAA

Gene: Desal_3727: ATP synthase protein I
*
Desulfovibrio vulgaris Hildenborough

Site:
position = 61
score = 4.23162
sequence = CTTGTGAACGATTGCACGAA

Gene: DVU0920: ATP synthase protein I
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -76
score = 4.25999
sequence = CTTGTGAACGTTTGCACGAA

Site:
position = -148
score = 4.13931
sequence = GTGGGGAATTTTTTCACGAA

Gene: DvMF_1386: ATP synthase protein I
 
Lawsonia intracellularis PHE/MN1-00
ATP synthase protein I
atpI2
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2088: ATP synthase protein I2
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2796: ATP synthase protein I2
 
Desulfovibrio desulfuricans G20

Gene: Dde_2699: ATP synthase protein I2
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2253: ATP synthase protein I2
 
Desulfovibrio magneticus RS-1

Gene: DMR_42150: ATP synthase protein I2
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02070: ATP synthase protein I2
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3726: ATP synthase protein I2
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0919: ATP synthase protein I2
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1387: ATP synthase protein I2
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI1056: ATP synthase protein I2
ATP synthase protein I2
atpB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2087: ATP synthase A chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2795: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2700: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2254: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_42160: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02069: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3725: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0918: ATP synthase A chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1388: ATP synthase A chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI1057: ATP synthase A chain (EC 3.6.3.14)
ATP synthase A chain (EC 3.6.3.14)
atpE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2086: ATP synthase C chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2794: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2701: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2255: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_42170: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02068: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3724: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0917: ATP synthase C chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1389: ATP synthase C chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI1058: ATP synthase C chain (EC 3.6.3.14)
ATP synthase C chain (EC 3.6.3.14)
rex
*
Desulfohalobium retbaense DSM 5692

Site:
position = -19
score = 4.54711
sequence = ATTGTGAAATTTAGAGCAAA

Gene: Dret_2085: Redox-sensing transcriptional repressor Rex
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -39
score = 4.41033
sequence = TTAGTGAAATAACTCACGAA

Gene: Dbac_2793: Redox-sensing transcriptional repressor Rex
*
Desulfovibrio desulfuricans G20

Site:
position = -48
score = 4.97804
sequence = CTCGTTATTTATTTCACATT

Gene: Dde_2702: Redox-sensing transcriptional repressor Rex
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2257: Redox-sensing transcriptional repressor Rex
 
Desulfovibrio magneticus RS-1

Gene: DMR_42180: Redox-sensing transcriptional repressor Rex
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02066: Redox-sensing transcriptional repressor Rex
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3723: Redox-sensing transcriptional repressor Rex
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0916: Redox-sensing transcriptional repressor Rex
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1390: Redox-sensing transcriptional repressor Rex
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI1059: Redox-sensing transcriptional repressor Rex
Redox-sensing transcriptional repressor Rex
 
CRON 4.
phsA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2860: thiosulfate reductase, putative
*
Desulfovibrio desulfuricans G20

Site:
position = -114
score = 5.15809
sequence = ATTGTGCTTTTTTGCACAAT

Gene: Dde_1076: thiosulfate reductase, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1667: thiosulfate reductase, putative
 
Desulfovibrio magneticus RS-1

Gene: DMR_08220: thiosulfate reductase, putative
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00534: thiosulfate reductase, putative
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0173: thiosulfate reductase, putative
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -175
score = 4.45556
sequence = ATCGTGATTGTTTTCACGAA

Gene: DvMF_0320: thiosulfate reductase, putative
 
Lawsonia intracellularis PHE/MN1-00
thiosulfate reductase, putative
phsB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2859: thiosulfate reductase, iron-sulfur binding subunit
 
Desulfovibrio desulfuricans G20

Gene: Dde_1075: thiosulfate reductase, iron-sulfur binding subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1666: thiosulfate reductase, iron-sulfur binding subunit
 
Desulfovibrio magneticus RS-1

Gene: DMR_08240: thiosulfate reductase, iron-sulfur binding subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00535: thiosulfate reductase, iron-sulfur binding subunit
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0172: thiosulfate reductase, iron-sulfur binding subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0319: thiosulfate reductase, iron-sulfur binding subunit
 
Lawsonia intracellularis PHE/MN1-00
thiosulfate reductase, iron-sulfur binding subunit
 
CRON 5.
hycA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -133
score = 5.67063
sequence = TTTGTGAAAATAATCACAAA

Gene: DMR_02450: NADP-reducing Fe-hydrogenase, subunit A
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
NADP-reducing Fe-hydrogenase, subunit A
hycB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_02460: NADP-reducing hydrogenase, subunit B
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
NADP-reducing hydrogenase, subunit B
hycC
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_02470: NADP-reducing Fe-hydrogenase, subunit C
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
NADP-reducing Fe-hydrogenase, subunit C
hycD
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_02480: NADP-reducing Fe-hydrogenase, subunit D
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
NADP-reducing Fe-hydrogenase, subunit D
 
CRON 6.
cooM
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -110
score = 4.25022
sequence = TTTACTATTTTTTTCACGAT

Gene: Ddes_1880: Carbon monoxide-induced hydrogenase membrane protein CooM
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02345: Carbon monoxide-induced hydrogenase membrane protein CooM
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -116
score = 4.39454
sequence = ATTGGGAATCGATTCACAAA

Gene: DVU2286: Carbon monoxide-induced hydrogenase membrane protein CooM
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3194: Carbon monoxide-induced hydrogenase membrane protein CooM
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced hydrogenase membrane protein CooM
cooK
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1881: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02343: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2287: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3193: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
cooL
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1882: Carbon monoxide-induced hydrogenase small subunit CooL
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02342: Carbon monoxide-induced hydrogenase small subunit CooL
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2288: Carbon monoxide-induced hydrogenase small subunit CooL
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3192: Carbon monoxide-induced hydrogenase small subunit CooL
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced hydrogenase small subunit CooL
cooX
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1883: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02341: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2289: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3191: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
cooU
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1884: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02340: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2290: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3190: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced hydrogenase NuoC-like protein CooU
cooH
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1885: Carbon monoxide-induced hydrogenase large subunit CooH
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02339: Carbon monoxide-induced hydrogenase large subunit CooH
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2291: Carbon monoxide-induced hydrogenase large subunit CooH
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3189: Carbon monoxide-induced hydrogenase large subunit CooH
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced hydrogenase large subunit CooH
hypA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1886: [NiFe] hydrogenase nickel incorporation protein HypA
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02338: [NiFe] hydrogenase nickel incorporation protein HypA
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2292: [NiFe] hydrogenase nickel incorporation protein HypA
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3188: [NiFe] hydrogenase nickel incorporation protein HypA
 
Lawsonia intracellularis PHE/MN1-00
[NiFe] hydrogenase nickel incorporation protein HypA
cooF
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1887: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02337: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2293: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3187: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
 
Lawsonia intracellularis PHE/MN1-00
Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
 
CRON 7.
Desal_2447
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1800: cytochrome c class III
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_21540: cytochrome c class III
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -144
score = 4.70454
sequence = TGTGTGAAAATTTTCCCAAT

Site:
position = -275
score = 4.6753
sequence = TTTGTGCAAAAATTACCAAA

Gene: Desal_2447: cytochrome c class III
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
cytochrome c class III
 
CRON 8.
ppaC
*
Desulfohalobium retbaense DSM 5692

Site:
position = -84
score = 5.33586
sequence = TTTGTGCTATTTGGCACAAA

Gene: Dret_1594: Manganese-dependent inorganic pyrophosphatase
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -58
score = 5.29144
sequence = ATTGTGATATTTAGCACAAT

Gene: Dbac_0143: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Desulfovibrio desulfuricans G20

Site:
position = -78
score = 5.15098
sequence = ATTGTGCTATTTGGCACAAA

Gene: Dde_1778: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -70
score = 4.37327
sequence = TTTGTGCTAAAGAGTACAAA

Gene: Ddes_0968: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Desulfovibrio magneticus RS-1

Site:
position = -79
score = 5.33655
sequence = ATTGGGATATTATTCACAAG

Gene: DMR_25800: Manganese-dependent inorganic pyrophosphatase
*
Desulfovibrio piger ATCC 29098

Site:
position = -101
score = 4.57921
sequence = CTTGTGCTAAAGGTAACAAG

Gene: DESPIG_01072: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -57
score = 4.5463
sequence = ATTGTGATAGAAGACACAAG

Gene: Desal_2248: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -79
score = 5.15098
sequence = ATTGTGCTATTTGGCACAAA

Gene: DVU1636: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -92
score = 5.33586
sequence = TTTGTGCTATTTGGCACAAA

Gene: DvMF_0420: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 
Lawsonia intracellularis PHE/MN1-00
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
 
CRON 9.
adk
*
Desulfohalobium retbaense DSM 5692

Site:
position = -29
score = 4.80168
sequence = TTTGTGAAATTTTTCTTCAG

Gene: Dret_1683: Adenylate kinase (EC 2.7.4.3)
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -31
score = 5.20428
sequence = TTTGTGAAATTTTTTACAGG

Gene: Dbac_0784: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio desulfuricans G20

Site:
position = -12
score = 5.08179
sequence = TTCGTGAAATAAATGACAAG

Gene: Dde_2028: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -51
score = 4.62568
sequence = TGTGTTCTTTTTTGCACAAT

Gene: Ddes_1956: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio magneticus RS-1

Site:
position = -32
score = 4.3073
sequence = ATTGTGAAAAATCAAACATG

Gene: DMR_16390: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio piger ATCC 29098

Site:
position = -55
score = 4.70581
sequence = TCTGTTCTTTTTTGCACAAA

Gene: DESPIG_01460: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -39
score = 5.09005
sequence = TTTGTGAAATTTGTTACTAA

Gene: Desal_1973: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -30
score = 5.04052
sequence = CTCGTGAAATTAATGACAAG

Gene: DVU1932: Adenylate kinase (EC 2.7.4.3)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -30
score = 5.07445
sequence = CTCGTGAAAATTATTACAAG

Gene: DvMF_0293: Adenylate kinase (EC 2.7.4.3)
 
Lawsonia intracellularis PHE/MN1-00
Adenylate kinase (EC 2.7.4.3)
 
CRON 10.
Dde_2506
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -145
score = 4.74465
sequence = TACGTTAAAAAAATCACAAT

Gene: Dde_2506: Sulfate transporter family protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -173
score = 4.99261
sequence = CTTGGGAATTAAAGCACAAA

Gene: Desal_2181: Sulfate transporter family protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0279: Sulfate transporter family protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1575: Sulfate transporter family protein
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0752: Sulfate transporter family protein
Sulfate transporter family protein
 
CRON 11.
qrcA
*
Desulfohalobium retbaense DSM 5692

Site:
position = -102
score = 4.70273
sequence = CTCGTGAAATTGTGCACAGG

Site:
position = -176
score = 4.83098
sequence = ATCGTGAAATTTTTCATGAG

Gene: Dret_0270: cytochrome c class III family protein
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -116
score = 4.52435
sequence = ATCGTGATTTTTTTCATTAT

Gene: Dbac_3390: cytochrome c class III family protein
*
Desulfovibrio desulfuricans G20

Site:
position = -110
score = 4.95108
sequence = TTCGTGAATTTTTTCACCTT

Gene: Dde_2932: cytochrome c class III family protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -217
score = 4.97681
sequence = TTCGTGAATTTTTTCATTAG

Gene: DMR_18010: cytochrome c class III family protein
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -112
score = 4.82794
sequence = TTTGTGAAAAGTTTCATATT

Gene: Desal_1042: cytochrome c class III family protein
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -112
score = 5.05807
sequence = TTCGTGAAATATTTCACCTT

Gene: DvMF_2690: cytochrome c class III family protein
 
Lawsonia intracellularis PHE/MN1-00
cytochrome c class III family protein
qrcB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0271: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3391: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
 
Desulfovibrio desulfuricans G20

Gene: Dde_2933: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_18020: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1043: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -755
score = 5.05807
sequence = TTCGTGAAATATTTCACCTT

Gene: DVU0694: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2689: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
 
Lawsonia intracellularis PHE/MN1-00
molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
qrcC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0272: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3392: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Desulfovibrio desulfuricans G20

Gene: Dde_2934: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_18030: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1044: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0693: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2688: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
 
Lawsonia intracellularis PHE/MN1-00
molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
qrcD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0273: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3393: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Desulfovibrio desulfuricans G20

Gene: Dde_2935: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_18040: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1045: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0692: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2687: molybdopterin oxidoreductase, transmembrane subunit, putative
 
Lawsonia intracellularis PHE/MN1-00
molybdopterin oxidoreductase, transmembrane subunit, putative
 
CRON 12.
apsB
*
Desulfohalobium retbaense DSM 5692

Site:
position = -167
score = 4.43839
sequence = CTTGCGCTAAATTTCACTTT

Gene: Dret_1967: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -95
score = 5.1654
sequence = TTTGATAAAAGATTCACAAG

Gene: Dbac_3197: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio desulfuricans G20

Site:
position = -188
score = 5.58002
sequence = TTTGTTAAATATCTCACAAG

Gene: Dde_1109: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -140
score = 4.41034
sequence = CTTGTTACTAATTGCGCAAG

Gene: Ddes_2130: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio magneticus RS-1

Site:
position = -279
score = 4.42201
sequence = CTTGTTAAACCGATCACAAG

Gene: DMR_05390: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio piger ATCC 29098

Site:
position = -142
score = 4.44592
sequence = CTTGTTACTAAAAACACAAG

Gene: DESPIG_02774: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -146
score = 4.68681
sequence = CTTGTTCTAAATTTCACTTT

Gene: Desal_0229: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -168
score = 4.58896
sequence = ATTGTTAATTCCATCACAAG

Gene: DVU0846: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -171
score = 5.13127
sequence = ATTGTTAAATCAGTCACAAG

Gene: DvMF_2892: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
 
Lawsonia intracellularis PHE/MN1-00
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1966: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3198: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio desulfuricans G20

Gene: Dde_1110: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2129: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio magneticus RS-1

Gene: DMR_05400: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02773: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0230: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0847: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2893: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Lawsonia intracellularis PHE/MN1-00
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
qmoA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1965: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3199: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio desulfuricans G20

Gene: Dde_1111: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2127: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio magneticus RS-1

Gene: DMR_05410: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02771: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0231: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0848: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2894: quinone-interacting membrane-bound oxidoreductase complex subunit A
 
Lawsonia intracellularis PHE/MN1-00
quinone-interacting membrane-bound oxidoreductase complex subunit A
qmoB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1964: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3200: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio desulfuricans G20

Gene: Dde_1112: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2126: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio magneticus RS-1

Gene: DMR_05420: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02770: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0232: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0849: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2895: quinone-interacting membrane-bound oxidoreductase complex subunit B
 
Lawsonia intracellularis PHE/MN1-00
quinone-interacting membrane-bound oxidoreductase complex subunit B
qmoC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1963: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3201: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio desulfuricans G20

Gene: Dde_1113: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2125: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio magneticus RS-1

Gene: DMR_05430: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02769: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0233: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0850: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2896: quinone-interacting membrane-bound oxidoreductase complex subunit C
 
Lawsonia intracellularis PHE/MN1-00
quinone-interacting membrane-bound oxidoreductase complex subunit C
Dret_1962
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1962: hypothetical protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3202: hypothetical protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_1114: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2124: hypothetical protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_05440: hypothetical protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02768: hypothetical protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0234: hypothetical protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0851: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2897: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
 
CRON 13.
atpF1
*
Desulfohalobium retbaense DSM 5692

Site:
position = -35
score = 4.30625
sequence = TTTGAACCAAAATTCACATA

Gene: Dret_2217: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -36
score = 4.86799
sequence = TTTGAACAAAAATTCACAAC

Gene: Dbac_3361: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio desulfuricans G20

Site:
position = -38
score = 4.90083
sequence = TTTGAGCTTAAATTCACAAC

Site:
position = -121
score = 4.97725
sequence = TTCAGGAAATTTTTCACAAG

Gene: Dde_0990: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -113
score = 5.04945
sequence = CTTGCGAAATTTGTCACCAA

Gene: Ddes_2183: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio magneticus RS-1

Site:
position = -163
score = 4.62286
sequence = TTCGGTCAATTCTTCACAAA

Site:
position = -36
score = 5.10432
sequence = TTTGCAAAAATTTTCACAAC

Gene: DMR_04760: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio piger ATCC 29098

Site:
position = -99
score = 4.98372
sequence = TTTGCGAATTTTGTCACCAA

Gene: DESPIG_02016: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -150
score = 4.52037
sequence = TTAGTTAAAAAAATAACAAG

Site:
position = -36
score = 4.76213
sequence = TTTGGACAAAAATTCACAAC

Gene: Desal_3459: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -59
score = 5.0124
sequence = TTTGAGCTTTAATTCACAAC

Gene: DVU0780: ATP synthase B' chain (EC 3.6.3.14)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -38
score = 4.90083
sequence = TTTGAGCTTAAATTCACAAC

Gene: DvMF_2826: ATP synthase B' chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0398: ATP synthase B' chain (EC 3.6.3.14)
ATP synthase B' chain (EC 3.6.3.14)
atpF2
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2216: ATP synthase F0, B subunit
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3362: ATP synthase F0, B subunit
 
Desulfovibrio desulfuricans G20

Gene: Dde_0989: ATP synthase F0, B subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2184: ATP synthase F0, B subunit
 
Desulfovibrio magneticus RS-1

Gene: DMR_04770: ATP synthase F0, B subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02015: ATP synthase F0, B subunit
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3458: ATP synthase F0, B subunit
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0779: ATP synthase F0, B subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2827: ATP synthase F0, B subunit
*
Lawsonia intracellularis PHE/MN1-00

Site:
position = -171
score = 4.69682
sequence = TATGTTAAATGAAGCACAAG

Gene: LI0399: ATP synthase F0, B subunit
ATP synthase F0, B subunit
atpH
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2215: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3363: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0988: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2185: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_04780: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02014: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3457: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0778: ATP synthase delta chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2828: ATP synthase delta chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0400: ATP synthase delta chain (EC 3.6.3.14)
ATP synthase delta chain (EC 3.6.3.14)
atpA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2214: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3364: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0987: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2186: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_04790: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02013: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3456: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0777: ATP synthase alpha chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2829: ATP synthase alpha chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0401: ATP synthase alpha chain (EC 3.6.3.14)
ATP synthase alpha chain (EC 3.6.3.14)
atpG
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2213: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3365: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0986: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2187: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_04800: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02012: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3455: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0776: ATP synthase gamma chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2830: ATP synthase gamma chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0402: ATP synthase gamma chain (EC 3.6.3.14)
ATP synthase gamma chain (EC 3.6.3.14)
atpD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2212: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3366: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0985: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2188: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_04810: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02011: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3454: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0775: ATP synthase beta chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2831: ATP synthase beta chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0403: ATP synthase beta chain (EC 3.6.3.14)
ATP synthase beta chain (EC 3.6.3.14)
atpC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2211: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3367: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0984: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2189: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio magneticus RS-1

Gene: DMR_04820: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02010: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3453: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0774: ATP synthase epsilon chain (EC 3.6.3.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2832: ATP synthase epsilon chain (EC 3.6.3.14)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0404: ATP synthase epsilon chain (EC 3.6.3.14)
ATP synthase epsilon chain (EC 3.6.3.14)
 
CRON 14.
sat
*
Desulfohalobium retbaense DSM 5692

Site:
position = -273
score = 4.8212
sequence = CTTGTGCAATAGCGCACAAG

Site:
position = -130
score = 5.07638
sequence = ATTGATAAAAAAATCACAAA

Gene: Dret_1968: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -43
score = 4.86449
sequence = TTTGTGAAAATAAAAACAAA

Site:
position = -114
score = 4.77056
sequence = GTTGATAAAAAAATCACAAA

Gene: Dbac_3196: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio desulfuricans G20

Site:
position = -149
score = 5.51416
sequence = TTTGCTAAAAATTTCACAAG

Gene: Dde_2265: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -108
score = 5.44022
sequence = TTTGTTAGATTATTCACAAG

Gene: Ddes_0454: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio magneticus RS-1

Site:
position = -140
score = 4.22958
sequence = TTTGACACATTTTTCACTTG

Gene: DMR_39470: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio piger ATCC 29098

Site:
position = -82
score = 5.44022
sequence = TTTGTTAGATTATTCACAAG

Gene: DESPIG_02241: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -242
score = 4.58698
sequence = CTTGACATTTCTTTCACAAA

Gene: Desal_0228: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -150
score = 5.69286
sequence = TTTGTAAATTTTTTCACAAG

Gene: DVU1295: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -164
score = 5.355
sequence = TATGTAAAATATTTCACAAG

Gene: DvMF_0074: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
Lawsonia intracellularis PHE/MN1-00
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
 
CRON 15.
dsrA
*
Desulfohalobium retbaense DSM 5692

Site:
position = -109
score = 4.07808
sequence = GTTGTACGAAAAATCACAAT

Gene: Dret_0244: Sulfite reductase alpha subunit (EC 1.8.99.1)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0279: Sulfite reductase alpha subunit (EC 1.8.99.1)
*
Desulfovibrio desulfuricans G20

Site:
position = -153
score = 4.16405
sequence = TTTGTCCAAAAAATCACGTA

Gene: Dde_0526: Sulfite reductase alpha subunit (EC 1.8.99.1)
*2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -209
score = 4.03468
sequence = ATTTTTAAATATAAAACAAA

Gene: Ddes_0921: Sulfite reductase alpha subunit (EC 1.8.99.1)

Gene: Ddes_2295: Sulfite reductase alpha subunit (EC 1.8.99.1)
*
Desulfovibrio magneticus RS-1

Site:
position = -166
score = 4.09135
sequence = ATTGTTCAAAACTTCACGTT

Gene: DMR_03600: Sulfite reductase alpha subunit (EC 1.8.99.1)
 4
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01910: Sulfite reductase alpha subunit (EC 1.8.99.1)

Gene: DESPIG_01911: Sulfite reductase alpha subunit (EC 1.8.99.1)

Gene: DESPIG_01918: Sulfite reductase alpha subunit (EC 1.8.99.1)

Gene: DESPIG_01917: Sulfite reductase alpha subunit (EC 1.8.99.1)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -177
score = 4.17961
sequence = GTTGTGTTTTTTTTCACTTA

Gene: Desal_0787: Sulfite reductase alpha subunit (EC 1.8.99.1)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -155
score = 4.49632
sequence = TTTGTCCAAAAAATCACGAG

Gene: DVU0402: Sulfite reductase alpha subunit (EC 1.8.99.1)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -151
score = 4.49632
sequence = TTTGTCCAAAAAATCACGAG

Gene: DvMF_1553: Sulfite reductase alpha subunit (EC 1.8.99.1)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0245: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0280: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0527: Sulfite reductase beta subunit (EC 1.8.99.1)
 2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0920: Sulfite reductase beta subunit (EC 1.8.99.1)

Gene: Ddes_2294: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Desulfovibrio magneticus RS-1

Gene: DMR_03610: Sulfite reductase beta subunit (EC 1.8.99.1)
 2
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01909: Sulfite reductase beta subunit (EC 1.8.99.1)

Gene: DESPIG_01916: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0788: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0403: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1554: Sulfite reductase beta subunit (EC 1.8.99.1)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0246: Dissimilatory sulfite reductase D
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0281: Dissimilatory sulfite reductase D
 
Desulfovibrio desulfuricans G20

Gene: Dde_0528: Dissimilatory sulfite reductase D
 2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0919: Dissimilatory sulfite reductase D

Gene: Ddes_2293: Dissimilatory sulfite reductase D
 
Desulfovibrio magneticus RS-1

Gene: DMR_03620: Dissimilatory sulfite reductase D
 2
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01908: Dissimilatory sulfite reductase D

Gene: DESPIG_01915: Dissimilatory sulfite reductase D
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0789: Dissimilatory sulfite reductase D
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0404: Dissimilatory sulfite reductase D
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1555: Dissimilatory sulfite reductase D
 
Lawsonia intracellularis PHE/MN1-00
Dissimilatory sulfite reductase D
 
CRON 16.
hysB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1970: periplasmic [NiFeSe] hydrogenase, small subunit
*
Desulfovibrio desulfuricans G20

Site:
position = -48
score = 4.18041
sequence = TTTGTAAAACTGTGCACAGG

Gene: Dde_2134: periplasmic [NiFeSe] hydrogenase, small subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00297: periplasmic [NiFeSe] hydrogenase, small subunit
*
Desulfovibrio salexigens DSM 2638

Site:
position = 21
score = 4.6608
sequence = TTCGTGAAAATGTGCACAGG

Gene: Desal_2050: periplasmic [NiFeSe] hydrogenase, small subunit
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -288
score = 4.09023
sequence = CGAGCTATATATTTCACAAA

Gene: DVU1917: periplasmic [NiFeSe] hydrogenase, small subunit
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = 21
score = 4.24824
sequence = TTCGTCAAATTGTGCACAGG

Gene: DvMF_0274: periplasmic [NiFeSe] hydrogenase, small subunit
 
Lawsonia intracellularis PHE/MN1-00
periplasmic [NiFeSe] hydrogenase, small subunit
hysA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1969: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
Desulfovibrio desulfuricans G20

Gene: Dde_2135: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00296: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2049: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1918: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0273: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
Lawsonia intracellularis PHE/MN1-00
periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
 
CRON 17.
Dde_1591
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1974: metal dependent phosphohydrolase
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0374: metal dependent phosphohydrolase
*
Desulfovibrio desulfuricans G20

Site:
position = -83
score = 4.85868
sequence = ATTGTGCATTATTTAACTAG

Gene: Dde_1591: metal dependent phosphohydrolase
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1422: metal dependent phosphohydrolase
 
Desulfovibrio magneticus RS-1

Gene: DMR_10900: metal dependent phosphohydrolase
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00603: metal dependent phosphohydrolase
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3218: metal dependent phosphohydrolase
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -54
score = 4.11731
sequence = CTTGTGGTGTTTTACACAAA

Gene: null: metal dependent phosphohydrolase
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0761: metal dependent phosphohydrolase
 
Lawsonia intracellularis PHE/MN1-00
metal dependent phosphohydrolase
Dde_1590
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_1590: Glycosyl transferase, family 2
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2059: Glycosyl transferase, family 2
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0762: Glycosyl transferase, family 2
 
Lawsonia intracellularis PHE/MN1-00
Glycosyl transferase, family 2
 
CRON 18.
DVU1292
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -40
score = 4.05254
sequence = TATGTGAAAAAAATCATTTT

Gene: DVU1292: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
Dret_0234
*
Desulfohalobium retbaense DSM 5692

Site:
position = -70
score = 3.84183
sequence = AATGTGAAATTCGGCACACA

Gene: Dret_0234: hypothetical protein
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -134
score = 4.9385
sequence = CTTGTTTCATTTTTCACAAA

Gene: Dbac_0269: hypothetical protein
*
Desulfovibrio desulfuricans G20

Site:
position = -167
score = 3.97665
sequence = TATGTGAAAAAAATAATTAT

Gene: Dde_2270: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0452: hypothetical protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_03730: hypothetical protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02238: hypothetical protein
*
Desulfovibrio salexigens DSM 2638

Site:
position = -118
score = 3.8697
sequence = AGTGTGACAGAATTCACATT

Gene: Desal_0187: hypothetical protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1291: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0071: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
dsrM
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0235: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0270: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2271: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0451: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio magneticus RS-1

Gene: DMR_03720: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02237: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0186: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1290: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0070: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
dsrK
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0236: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0271: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2272: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0450: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio magneticus RS-1

Gene: DMR_03710: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02236: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0185: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1289: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0069: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
dsrJ
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0237: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0272: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2273: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0449: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio magneticus RS-1

Gene: DMR_03700: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02235: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0184: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1288: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0068: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
dsrO
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0238: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0273: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2274: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0448: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio magneticus RS-1

Gene: DMR_03690: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02234: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0183: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1287: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0067: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
dsrP
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0239: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0274: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio desulfuricans G20

Gene: Dde_2275: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0447: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio magneticus RS-1

Gene: DMR_03680: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02233: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0182: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1286: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0066: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
Lawsonia intracellularis PHE/MN1-00
Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
 
CRON 19.
Dde_1140
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1355: MgtC/SapB transporter
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -107
score = 4.52152
sequence = CATGTGAAATTTTTCCCGAA

Gene: Dde_1140: MgtC/SapB transporter
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
MgtC/SapB transporter
 
CRON 20.
hupB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1900: DNA-binding protein HU-beta (hupB)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2463: DNA-binding protein HU-beta (hupB)
*
Desulfovibrio desulfuricans G20

Site:
position = -106
score = 4.7737
sequence = CTTGAGAAAAAAATCTCAAA

Gene: Dde_2058: DNA-binding protein HU-beta (hupB)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1090: DNA-binding protein HU-beta (hupB)
 
Desulfovibrio magneticus RS-1

Gene: DMR_20640: DNA-binding protein HU-beta (hupB)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00280: DNA-binding protein HU-beta (hupB)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1606: DNA-binding protein HU-beta (hupB)
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -113
score = 4.52522
sequence = TTTGGGAAAAAAAGCGCAAG

Gene: DVU1795: DNA-binding protein HU-beta (hupB)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -96
score = 4.50441
sequence = CTTGAGAAAAAAGGCGCAAA

Gene: DvMF_0500: DNA-binding protein HU-beta (hupB)
 
Lawsonia intracellularis PHE/MN1-00
DNA-binding protein HU-beta (hupB)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD