Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TmcR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode:
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20 9 1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio vulgaris Hildenborough 9 1
Desulfovibrio vulgaris str. Miyazaki F 8 1
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tmcD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1030: hypothetical protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0564: hypothetical protein
*
Desulfovibrio desulfuricans G20

Site:
position = -149
score = 5.31088
sequence = TACTCCACCACTACAGTATAGTT

Site:
position = -83
score = 5.82314
sequence = ATGTCTACCCAAAAGATAGAGTT

Site:
position = -217
score = 6.14688
sequence = TTCTATACCAAACAGGTATAGTA

Gene: Dde_3707: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_42520: hypothetical protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3043: hypothetical protein
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -182
score = 5.87483
sequence = TTGTCTACCATGACAGTAGTATT

Gene: DVU0266: hypothetical protein
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -170
score = 6.13729
sequence = AAATCTACCACGCAAGTAGACTA

Site:
position = -195
score = 5.6944
sequence = AACTATACCATTGCAGTATACAA

Gene: DvMF_2557: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
tmcC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1029: Transmembrane complex, integral membrane protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0565: Transmembrane complex, integral membrane protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_3708: Transmembrane complex, integral membrane protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_42510: Transmembrane complex, integral membrane protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3042: Transmembrane complex, integral membrane protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0265: Transmembrane complex, integral membrane protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2556: Transmembrane complex, integral membrane protein
 
Lawsonia intracellularis PHE/MN1-00
Transmembrane complex, integral membrane protein
tmcB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1028: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0566: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Desulfovibrio desulfuricans G20

Gene: Dde_3709: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_42500: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3041: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0264: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2555: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
 
Lawsonia intracellularis PHE/MN1-00
Transmembrane complex, ferredoxin, 2 [4Fe-4S]
tmcA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1027: cytochrome c class III
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0567: cytochrome c class III
 
Desulfovibrio desulfuricans G20

Gene: Dde_3710: cytochrome c class III
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_42490: cytochrome c class III
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3040: cytochrome c class III
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0263: cytochrome c class III
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2554: cytochrome c class III
 
Lawsonia intracellularis PHE/MN1-00
cytochrome c class III
Dde_3711
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_3711: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0262: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2553: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
DVU0261
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0871: Universal stress protein family
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0574: Universal stress protein family
 
Desulfovibrio desulfuricans G20

Gene: Dde_3712: Universal stress protein family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_12890: Universal stress protein family
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1372: Universal stress protein family
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0261: Universal stress protein family
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2552: Universal stress protein family
 
Lawsonia intracellularis PHE/MN1-00
Universal stress protein family
mtrA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0870: response regulator receiver protein
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_3713: response regulator receiver protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1371: response regulator receiver protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0260: response regulator receiver protein
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
response regulator receiver protein
divK
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0869: response regulator receiver protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0575: response regulator receiver protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_3714: response regulator receiver protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_12900: response regulator receiver protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1370: response regulator receiver protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0259: response regulator receiver protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2551: response regulator receiver protein
 
Lawsonia intracellularis PHE/MN1-00
response regulator receiver protein
DVU0258
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0868: multi-sensor signal transduction histidine kinase
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0576: multi-sensor signal transduction histidine kinase
 
Desulfovibrio desulfuricans G20

Gene: Dde_3715: multi-sensor signal transduction histidine kinase
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_12910: multi-sensor signal transduction histidine kinase
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1369: multi-sensor signal transduction histidine kinase
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0258: multi-sensor signal transduction histidine kinase
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2550: multi-sensor signal transduction histidine kinase
 
Lawsonia intracellularis PHE/MN1-00
multi-sensor signal transduction histidine kinase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD