Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HmcR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode:
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692 11 1
Desulfomicrobium baculatum DSM 4028 10 1
Desulfovibrio desulfuricans G20 7 1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 11 1
Desulfovibrio vulgaris Hildenborough 8 1
Desulfovibrio vulgaris str. Miyazaki F 8 1
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hmcA
*
Desulfohalobium retbaense DSM 5692

Site:
position = -158
score = 5.06
sequence = TCGCCTACTCAGCCGGTAGGTTT

Site:
position = -133
score = 5.49097
sequence = ATACCTACCACTGAAGTAGGATT

Gene: Dret_0877: High-molecular-weight cytochrome c precursor
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -194
score = 4.58292
sequence = TTCTATACCTCCGAGGTCGGAAT

Gene: Dbac_0568: High-molecular-weight cytochrome c precursor
*
Desulfovibrio desulfuricans G20

Site:
position = -291
score = 5.99331
sequence = TCGCATACCTCAGCGGTAGGAAA

Site:
position = -266
score = 5.4984
sequence = AATCATACCATGCAGGTAGGGTA

Gene: Dde_0653: High-molecular-weight cytochrome c precursor
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2038: High-molecular-weight cytochrome c precursor
 
Desulfovibrio magneticus RS-1

Gene: DMR_12830: High-molecular-weight cytochrome c precursor
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01443: High-molecular-weight cytochrome c precursor
*
Desulfovibrio salexigens DSM 2638

Site:
position = -176
score = 4.51788
sequence = ATACCAACCCGATGGATGGGAAA

Site:
position = -201
score = 4.74125
sequence = AAACCTATCTATTGAGGAGGTAT

Site:
position = -226
score = 5.53272
sequence = TAACATACCTATCGAGCAGGTAT

Gene: Desal_1378: High-molecular-weight cytochrome c precursor
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -210
score = 5.82369
sequence = TAGCATACCCCCGCAGTAGGATT

Site:
position = -185
score = 5.54755
sequence = TTCCATACTATACAGGTAGGGTA

Gene: DVU0536: High-molecular-weight cytochrome c precursor
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -346
score = 6.00332
sequence = TCGCATACCCCTCCGGTAGGAAT

Site:
position = -321
score = 5.915
sequence = TTCCATACCCTAGAAGTAGGGTA

Gene: DvMF_2598: High-molecular-weight cytochrome c precursor
 
Lawsonia intracellularis PHE/MN1-00
High-molecular-weight cytochrome c precursor
hmcB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0876: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0569: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0652: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2039: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12840: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01442: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1377: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0535: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2597: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Lawsonia intracellularis PHE/MN1-00
4Fe-4S ferredoxin iron-sulfur binding domain protein
hmcC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0875: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0570: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio desulfuricans G20

Gene: Dde_0651: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2040: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio magneticus RS-1

Gene: DMR_12850: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01441: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1376: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0534: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2596: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
 
Lawsonia intracellularis PHE/MN1-00
Ni/Fe-hydrogenase 2 B-type cytochrome subunit
hmcD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0874: hmc operon protein 4
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0571: hmc operon protein 4
 
Desulfovibrio desulfuricans G20

Gene: Dde_0650: hmc operon protein 4
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2041: hmc operon protein 4
 
Desulfovibrio magneticus RS-1

Gene: DMR_12860: hmc operon protein 4
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01440: hmc operon protein 4
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1375: hmc operon protein 4
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0533: hmc operon protein 4
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2595: hmc operon protein 4
 
Lawsonia intracellularis PHE/MN1-00
hmc operon protein 4
hmcE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0873: hmc operon protein 5
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0572: hmc operon protein 5
 
Desulfovibrio desulfuricans G20

Gene: Dde_0649: hmc operon protein 5
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0846: hmc operon protein 5
 
Desulfovibrio magneticus RS-1

Gene: DMR_12870: hmc operon protein 5
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1374: hmc operon protein 5
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0532: hmc operon protein 5
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2594: hmc operon protein 5
 
Lawsonia intracellularis PHE/MN1-00
hmc operon protein 5
hmcF
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0872: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0573: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0648: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0845: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12880: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1373: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0531: protein of unknown function DUF224 cysteine-rich region domain protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2593: protein of unknown function DUF224 cysteine-rich region domain protein
 
Lawsonia intracellularis PHE/MN1-00
protein of unknown function DUF224 cysteine-rich region domain protein
Dret_0871
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0871: Universal stress protein family
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0574: Universal stress protein family
 
Desulfovibrio desulfuricans G20

Gene: Dde_3712: Universal stress protein family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_12890: Universal stress protein family
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1372: Universal stress protein family
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0261: Universal stress protein family
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2552: Universal stress protein family
 
Lawsonia intracellularis PHE/MN1-00
Universal stress protein family
mtrA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0870: response regulator receiver protein
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_3713: Signal transduction response regulator, receiver region
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1371: response regulator receiver protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0260: Signal transduction response regulator, receiver region
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Signal transduction response regulator, receiver region
divK
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0869: response regulator receiver protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0575: response regulator receiver protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_3714: response regulator receiver protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_12900: response regulator receiver protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1370: response regulator receiver protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0259: response regulator receiver protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2551: response regulator receiver protein
 
Lawsonia intracellularis PHE/MN1-00
response regulator receiver protein
Dbac_0576
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0868: multi-sensor signal transduction histidine kinase
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0576: multi-sensor signal transduction histidine kinase
 
Desulfovibrio desulfuricans G20

Gene: Dde_3715: multi-sensor signal transduction histidine kinase
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_12910: multi-sensor signal transduction histidine kinase
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1369: multi-sensor signal transduction histidine kinase
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0258: multi-sensor signal transduction histidine kinase
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2550: multi-sensor signal transduction histidine kinase
 
Lawsonia intracellularis PHE/MN1-00
multi-sensor signal transduction histidine kinase
hmcR
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0867: Transcriptional regulator, BadM/Rrf2 family
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0577: Transcriptional regulator, BadM/Rrf2 family
 
Desulfovibrio desulfuricans G20

Gene: Dde_0647: Transcriptional regulator, BadM/Rrf2 family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1368: Transcriptional regulator, BadM/Rrf2 family
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0529: Transcriptional regulator, BadM/Rrf2 family
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2591: Transcriptional regulator, BadM/Rrf2 family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, BadM/Rrf2 family
rrf1
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0530: response regulator, rrf1 protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2592: response regulator, rrf1 protein
 
Lawsonia intracellularis PHE/MN1-00
response regulator, rrf1 protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD