Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog OhcR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: Fis
Regulation mode:
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692 2 1
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20 2 1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1 2 1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 4 1
Desulfovibrio vulgaris Hildenborough 3 1
Desulfovibrio vulgaris str. Miyazaki F 3 1
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ohcB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0164: iron-sulfur cluster-binding protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1361: iron-sulfur cluster-binding protein
*
Desulfovibrio desulfuricans G20

Site:
position = -178
score = 4.58814
sequence = CCATATGATTAGACATTATC

Site:
position = -190
score = 4.73159
sequence = ACATATGTCTAACCATATGA

Gene: Dde_0657: iron-sulfur cluster-binding protein
 2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0544: iron-sulfur cluster-binding protein

Gene: Ddes_2065: iron-sulfur cluster-binding protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_38630: iron-sulfur cluster-binding protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02228: iron-sulfur cluster-binding protein
*
Desulfovibrio salexigens DSM 2638

Site:
position = -201
score = 5.3347
sequence = ACATGTGTTTAATCATGTGT

Gene: Desal_0829: iron-sulfur cluster-binding protein
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -186
score = 4.93319
sequence = CATCATGATGCGTCATGTGC

Site:
position = -210
score = 4.35274
sequence = CCAGATGATGCATCGATTGA

Gene: DVU3143: iron-sulfur cluster-binding protein
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -204
score = 5.37424
sequence = CCATATGTCGCATCATATGC

Site:
position = -235
score = 4.77053
sequence = CAGCATGGCGCAACATGTGC

Gene: DvMF_1693: iron-sulfur cluster-binding protein
 
Lawsonia intracellularis PHE/MN1-00
iron-sulfur cluster-binding protein
Desal_0830
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0165: iron-sulfur cluster-binding protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1360: iron-sulfur cluster-binding protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0656: iron-sulfur cluster-binding protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2066: iron-sulfur cluster-binding protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_38620: iron-sulfur cluster-binding protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02229: iron-sulfur cluster-binding protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0830: iron-sulfur cluster-binding protein
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
iron-sulfur cluster-binding protein
ohcA
*
Desulfohalobium retbaense DSM 5692

Site:
position = -343
score = 4.98123
sequence = CACAATGTTTAAACATGTGT

Site:
position = -331
score = 4.56528
sequence = ACATGTGTTTAAACACCCTG

Gene: Dret_0167: cytochrome c family protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1392: cytochrome c family protein
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -228
score = 4.44998
sequence = GCACATGTCTAAGCAAGTGT

Gene: DMR_33620: cytochrome c family protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0831: cytochrome c family protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU3144: cytochrome c family protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1694: cytochrome c family protein
 
Lawsonia intracellularis PHE/MN1-00
cytochrome c family protein
ohcC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0166: Cytochrome B561
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1393: Cytochrome B561
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_33610: Cytochrome B561
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0832: Cytochrome B561
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU3145: Cytochrome B561
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1695: Cytochrome B561
 
Lawsonia intracellularis PHE/MN1-00
Cytochrome B561
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD