Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692 8 3
Desulfomicrobium baculatum DSM 4028 12 6
Desulfovibrio desulfuricans G20 19 7
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1 15 6
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 17 8
Desulfovibrio vulgaris Hildenborough 10 4
Desulfovibrio vulgaris str. Miyazaki F 10 6
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdnG
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -133
score = 5.20211
sequence = GTTGTGTTAATATTAACACATT

Gene: Dde_3512: formate dehydrogenase alpha subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -81
score = 4.57024
sequence = CGTGTGCCTGATTAGACATAAC

Site:
position = -226
score = 4.36446
sequence = TTTGTATTTAAAATAACTTAAT

Gene: DMR_15760: formate dehydrogenase alpha subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00974: formate dehydrogenase alpha subunit
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase alpha subunit
fdnG-3
 
Desulfohalobium retbaense DSM 5692
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -125
score = 4.78946
sequence = TATGTATTATTTATAACATATT

Gene: Dbac_1570: formate dehydrogenase, alpha subunit
 
Desulfovibrio desulfuricans G20

Gene: Dde_3513: formate dehydrogenase, alpha subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0555: formate dehydrogenase, alpha subunit
 
Desulfovibrio magneticus RS-1

Gene: DMR_15750: formate dehydrogenase, alpha subunit
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00975: formate dehydrogenase, alpha subunit
*
Desulfovibrio salexigens DSM 2638

Site:
position = -127
score = 4.96317
sequence = TATGTGCTAAATCTAACATATT

Gene: Desal_2659: formate dehydrogenase, alpha subunit
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -333
score = 4.21231
sequence = TATATGTTTTATTTAACCTACT

Gene: DVU2812: formate dehydrogenase, alpha subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0646: formate dehydrogenase, alpha subunit
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase, alpha subunit
fdhB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1569: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio desulfuricans G20

Gene: Dde_3514: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0556: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio magneticus RS-1

Gene: DMR_15740: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00976: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2658: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2811: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0647: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
 
Lawsonia intracellularis PHE/MN1-00
Formate dehydrogenase O beta subunit (EC 1.2.1.2)
fdhE
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1568: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio desulfuricans G20

Gene: Dde_3515: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0557: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio magneticus RS-1

Gene: DMR_15730: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00977: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2657: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2810: formate dehydrogenase formation protein FdhE, putative
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0648: formate dehydrogenase formation protein FdhE, putative
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase formation protein FdhE, putative
fdhD
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_3516: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Formate dehydrogenase chain D (EC 1.2.1.2)
DVU2809
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2809: cytochrome c3
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0649: cytochrome c3
 
Lawsonia intracellularis PHE/MN1-00
cytochrome c3
 
CRON 2.
Dde_0715
*
Desulfohalobium retbaense DSM 5692

Site:
position = -10
score = 4.96014
sequence = GTTATGTTTTATGAGGCATAAC

Gene: Dret_0225: hypothetical protein
 
Desulfomicrobium baculatum DSM 4028
*2
Desulfovibrio desulfuricans G20

Site:
position = -109
score = 4.64788
sequence = TTTATGCTTTTTTTAACAAAAA

Gene: Dde_0814: hypothetical protein

Site:
position = -177
score = 5.36046
sequence = GTTCTGCTATTATTAACATATT

Gene: Dde_0715: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -170
score = 4.60097
sequence = TGTGTGTTAATTGTAACATATT

Gene: DVU0586: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1218: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
fdnG-1
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0226: formate dehydrogenase, alpha subunit
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0971: formate dehydrogenase, alpha subunit
 3
Desulfovibrio desulfuricans G20

Gene: Dde_0813: formate dehydrogenase, alpha subunit

Gene: Dde_0716: formate dehydrogenase, alpha subunit

Gene: Dde_0717: formate dehydrogenase, alpha subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*2
Desulfovibrio magneticus RS-1

Site:
position = -97
score = 5.37224
sequence = CTTATGCTAATTTTAGCATAAC

Site:
position = -113
score = 4.7903
sequence = CCTATGTTATTTTTAACTTATG

Gene: DMR_24460: formate dehydrogenase, alpha subunit

Gene: DMR_24450: formate dehydrogenase, alpha subunit
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0587: formate dehydrogenase, alpha subunit
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1217: formate dehydrogenase, alpha subunit
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase, alpha subunit
fdhB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0227: formate dehydrogenase, beta subunit
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0970: formate dehydrogenase, beta subunit
 2
Desulfovibrio desulfuricans G20

Gene: Dde_0812: formate dehydrogenase, beta subunit

Gene: Dde_0718: formate dehydrogenase, beta subunit
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_24440: formate dehydrogenase, beta subunit
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 2
Desulfovibrio vulgaris Hildenborough

Gene: DVU2481: formate dehydrogenase, beta subunit

Gene: DVU0588: formate dehydrogenase, beta subunit
 2
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2534: formate dehydrogenase, beta subunit

Gene: DvMF_1216: formate dehydrogenase, beta subunit
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase, beta subunit
fdnG-2
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2482: formate dehydrogenase alpha subunit
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -179
score = 4.7232
sequence = ATTCTGTCAGGATAGGCATATA

Gene: DvMF_2533: formate dehydrogenase alpha subunit
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase alpha subunit
 
CRON 3.
aor-4
 
Desulfohalobium retbaense DSM 5692
*2
Desulfomicrobium baculatum DSM 4028

Site:
position = -120
score = 4.92698
sequence = GTTATGTCACCCATGACATATG

Gene: Dbac_2970: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)

Gene: Dbac_3328: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
*
Desulfovibrio desulfuricans G20

Site:
position = -196
score = 4.60893
sequence = TTTAGGTTAAAAATAACTTAAT

Gene: Dde_2460: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -169
score = 5.28822
sequence = AATATGCCAAAAAAGATATAAT

Gene: Desal_1641: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1179: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
 
CRON 4.
tupB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2398: ABC-type tungstate transport system, periplasmic binding protein
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -32
score = 4.36282
sequence = CGTATGTCATTTTTCACTTAAC

Site:
position = -62
score = 5.04009
sequence = CTTGTGTCTGATTTGGCATATG

Gene: Dbac_3402: ABC-type tungstate transport system, periplasmic binding protein
*
Desulfovibrio desulfuricans G20

Site:
position = -65
score = 4.35244
sequence = ATTGTGTTTTATTTAGCTGATT

Gene: Dde_0234: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1778: ABC-type tungstate transport system, periplasmic binding protein
*
Desulfovibrio magneticus RS-1

Site:
position = -30
score = 4.0888
sequence = GTTAAGTTAAATTTGACAGAGG

Gene: DMR_12510: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01703: ABC-type tungstate transport system, periplasmic binding protein
*
Desulfovibrio salexigens DSM 2638

Site:
position = -136
score = 4.80501
sequence = ATTGTGCTCATATTGACATAGA

Site:
position = -245
score = 4.08608
sequence = GATATATTTTAAACAGCATAGG

Gene: Desal_2876: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0745: ABC-type tungstate transport system, periplasmic binding protein
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -227
score = 4.50698
sequence = GTTCTGTTTTTTTCAACATGTT

Gene: DvMF_2780: ABC-type tungstate transport system, periplasmic binding protein
 
Lawsonia intracellularis PHE/MN1-00
ABC-type tungstate transport system, periplasmic binding protein
tupA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2397: ABC-type tungstate transport system, permease protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3403: ABC-type tungstate transport system, permease protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0233: ABC-type tungstate transport system, permease protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1777: ABC-type tungstate transport system, permease protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12520: ABC-type tungstate transport system, permease protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01702: ABC-type tungstate transport system, permease protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2875: ABC-type tungstate transport system, permease protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0746: ABC-type tungstate transport system, permease protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2781: ABC-type tungstate transport system, permease protein
 
Lawsonia intracellularis PHE/MN1-00
ABC-type tungstate transport system, permease protein
tupC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2396: ABC-type tungstate transport system, ATP-binding protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3404: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0232: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1776: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12530: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01701: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2874: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0747: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2782: ABC-type tungstate transport system, ATP-binding protein
 
Lawsonia intracellularis PHE/MN1-00
ABC-type tungstate transport system, ATP-binding protein
 
CRON 5.
fmdE
 
Desulfohalobium retbaense DSM 5692
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -227
score = 5.03375
sequence = ATGATGCCAAACAAGGCATAAT

Gene: Dbac_1566: Formylmethanofuran dehydrogenase subunit E
 
Desulfovibrio desulfuricans G20

Gene: Dde_0685: Formylmethanofuran dehydrogenase subunit E
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0554: Formylmethanofuran dehydrogenase subunit E
 
Desulfovibrio magneticus RS-1

Gene: DMR_08200: Formylmethanofuran dehydrogenase subunit E
 
Desulfovibrio piger ATCC 29098
*2
Desulfovibrio salexigens DSM 2638

Site:
position = -48
score = 5.06694
sequence = ATTGTGCCCTATACGGCATAAT

Gene: Desal_2666: Formylmethanofuran dehydrogenase subunit E

Gene: Desal_0380: Formylmethanofuran dehydrogenase subunit E
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0175: Formylmethanofuran dehydrogenase subunit E
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1613: Formylmethanofuran dehydrogenase subunit E
 
Lawsonia intracellularis PHE/MN1-00
Formylmethanofuran dehydrogenase subunit E
modE
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1565: Transcriptional regulator, ModE family
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2665: Transcriptional regulator, ModE family
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -143
score = 4.3038
sequence = ATTATGTCATTATGAGCAGGTA

Gene: DvMF_0650: Transcriptional regulator, ModE family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, ModE family
 
CRON 6.
fdhE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0279: formate dehydrogenase formation protein FdhE
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0982: formate dehydrogenase formation protein FdhE
 
Desulfovibrio desulfuricans G20

Gene: Dde_0706: formate dehydrogenase formation protein FdhE
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_24510: formate dehydrogenase formation protein FdhE
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -78
score = 4.13426
sequence = CATATGCTTTTTTTAACAGGAA

Site:
position = -178
score = 4.93638
sequence = ATTATACCATTTTAGCCATAAT

Gene: Desal_2878: formate dehydrogenase formation protein FdhE
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0577: formate dehydrogenase formation protein FdhE
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1233: formate dehydrogenase formation protein FdhE
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase formation protein FdhE
moaA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1734: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0240: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio desulfuricans G20

Gene: Dde_0709: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1269: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio magneticus RS-1

Gene: DMR_24480: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02699: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2879: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0580: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1230: Molybdenum cofactor biosynthesis protein MoaA
 
Lawsonia intracellularis PHE/MN1-00
Molybdenum cofactor biosynthesis protein MoaA
 
CRON 7.
mop
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*2
Desulfovibrio magneticus RS-1

Site:
position = -142
score = 5.35298
sequence = AATGTGTTAATAATAACATAAC

Gene: DMR_17150: molybdenum-pterin binding protein

Gene: DMR_19270: molybdenum-pterin binding protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2403: molybdenum-pterin binding protein
 
Lawsonia intracellularis PHE/MN1-00
molybdenum-pterin binding protein
 
CRON 8.
modE2
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -99
score = 5.08901
sequence = AATATGCTCAACAAGACATAAC

Gene: Dde_3511: Transcriptional regulator, ModE family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, ModE family
 
CRON 9.
phsA
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2860: molybdopterin oxidoreductase
 
Desulfovibrio desulfuricans G20

Gene: Dde_1076: molybdopterin oxidoreductase
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1667: molybdopterin oxidoreductase
 
Desulfovibrio magneticus RS-1

Gene: DMR_08220: molybdopterin oxidoreductase
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00534: molybdopterin oxidoreductase
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0173: molybdopterin oxidoreductase
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -216
score = 5.08254
sequence = CATATGTCTGAAAAAGCATAAT

Gene: DvMF_0320: molybdopterin oxidoreductase
 
Lawsonia intracellularis PHE/MN1-00
molybdopterin oxidoreductase
phsB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2859: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_1075: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1666: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0172: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0319: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Lawsonia intracellularis PHE/MN1-00
4Fe-4S ferredoxin iron-sulfur binding domain protein
 
CRON 10.
wtpA
*
Desulfohalobium retbaense DSM 5692

Site:
position = -32
score = 4.40957
sequence = TATATGTCTTTTTTAGCAAAGG

Gene: Dret_0525: ABC-type tungstate/molybdate transport system, periplasmic component
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -76
score = 4.37373
sequence = TTTCTGTCTTTGTTGACTTAAA

Gene: Dbac_2354: ABC-type tungstate/molybdate transport system, periplasmic component
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -106
score = 5.02761
sequence = ATTATGCTCTCCATGACATATG

Gene: Desal_2416: ABC-type tungstate/molybdate transport system, periplasmic component
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
ABC-type tungstate/molybdate transport system, periplasmic component
wtpB
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0526: ABC-type tungstate/molybdate transport system, permease protein
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2417: ABC-type tungstate/molybdate transport system, permease protein
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
ABC-type tungstate/molybdate transport system, permease protein
wtpC
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0527: ABC-type tungstate/molybdate transport system, ATP-binding component
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2418: ABC-type tungstate/molybdate transport system, ATP-binding component
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
ABC-type tungstate/molybdate transport system, ATP-binding component
 
CRON 11.
fdhD
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -143
score = 4.80797
sequence = TCTATGTCAATATGAGCACAAT

Gene: Desal_2877: formate dehydrogenase family accessory protein FdhD
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
formate dehydrogenase family accessory protein FdhD
 
CRON 12.
nifE
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0841: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -312
score = 4.75058
sequence = GTTGTGTCAAAACAGACAGAAG

Gene: DMR_17520: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0439: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
 
Desulfovibrio vulgaris Hildenborough

Gene: DVUA0009: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2620: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
 
Lawsonia intracellularis PHE/MN1-00
Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
nifN
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0842: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_17510: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0438: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
 
Desulfovibrio vulgaris Hildenborough

Gene: DVUA0008: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2621: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
 
Lawsonia intracellularis PHE/MN1-00
Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
nifB
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0843: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1

Gene: DMR_17500: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0437: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
 
Desulfovibrio vulgaris Hildenborough

Gene: DVUA0007: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2622: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
 
Lawsonia intracellularis PHE/MN1-00
Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
 
CRON 13.
DMR_02370
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio magneticus RS-1

Site:
position = -327
score = 4.20288
sequence = ATAATATTTAAAATAACATAGT

Gene: DMR_02370: putative tungsten-containing aldehyde ferredoxin oxidoreductase
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -258
score = 4.62984
sequence = CCTATGTCATGCAAGGCATAAA

Site:
position = -310
score = 4.65426
sequence = AATGTGTCACCATTGACATAGT

Gene: DvMF_1956: putative tungsten-containing aldehyde ferredoxin oxidoreductase
 
Lawsonia intracellularis PHE/MN1-00
putative tungsten-containing aldehyde ferredoxin oxidoreductase
 
CRON 14.
DVU1560
*
Desulfohalobium retbaense DSM 5692

Site:
position = -166
score = 4.59487
sequence = GCTATGCAAAAAATCACATAAG

Gene: Dret_1807: molybdopterin binding domain protein
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -192
score = 4.98562
sequence = GTTATGCCTTTCCGGGCATATT

Site:
position = -63
score = 5.37612
sequence = GATATGTCAATATTGACATGTT

Gene: Dbac_1563: molybdopterin binding domain protein
*
Desulfovibrio desulfuricans G20

Site:
position = -66
score = 4.69966
sequence = AATATGCCTGCACAGGCATATG

Gene: Dde_3538: molybdopterin binding domain protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1824: molybdopterin binding domain protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_05970: molybdopterin binding domain protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00474: molybdopterin binding domain protein
*
Desulfovibrio salexigens DSM 2638

Site:
position = -114
score = 5.24142
sequence = ATTATGTCTTTTTTGATATATC

Site:
position = -336
score = 5.18044
sequence = ATTATGTCATTTTGGACCTAAT

Gene: Desal_0300: molybdopterin binding domain protein
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -111
score = 4.30809
sequence = GTTATGCAAGTCTGTGCATAAG

Gene: DVU1560: molybdopterin binding domain protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0642: molybdopterin binding domain protein
 
Lawsonia intracellularis PHE/MN1-00
molybdopterin binding domain protein
mop
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1808: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1562: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio desulfuricans G20

Gene: Dde_3539: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1823: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio magneticus RS-1

Gene: DMR_05980: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00476: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0299: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1559: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0641: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
 
Lawsonia intracellularis PHE/MN1-00
aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
DVU2405
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0199: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3326: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Desulfovibrio desulfuricans G20

Gene: Dde_3523: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -332
score = 4.80559
sequence = TCTATGTTTTTTCTGGCATATG

Gene: DVU2405: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -331
score = 5.22062
sequence = ATTATGCTTTTTCAGACATATG

Gene: DvMF_0321: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Lawsonia intracellularis PHE/MN1-00
Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD