Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1 4 1
Thauera sp. MZ1T 5 3
Dechloromonas aromatica RCB 11 5
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans 6 3
Chromobacterium violaceum ATCC 12472
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lexA
*
Azoarcus sp. EbN1

Site:
position = -82
score = 5.74648
sequence = ATGTGTATAAATATACAGCA

Gene: ebA3086: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Thauera sp. MZ1T

Site:
position = -37
score = 5.86775
sequence = GACTGTTTAAAATTACAGCC

Gene: Tmz1t_2297: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Dechloromonas aromatica RCB

Site:
position = -44
score = 6.1293
sequence = TACTGTACAAAAATACAGTC

Gene: Daro_1939: SOS-response repressor and protease LexA (EC 3.4.21.88)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
*
Thiobacillus denitrificans

Site:
position = 125
score = 5.03145
sequence = TACTGTACGGACATACAGTA

Gene: Tbd_1483: SOS-response repressor and protease LexA (EC 3.4.21.88)
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
SOS-response repressor and protease LexA (EC 3.4.21.88)
imuA
 
Azoarcus sp. EbN1

Gene: ebA3084: Predicted RecA/RadA recombinase
 
Thauera sp. MZ1T

Gene: Tmz1t_2298: Predicted RecA/RadA recombinase
 
Dechloromonas aromatica RCB

Gene: Daro_1940: Predicted RecA/RadA recombinase
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
*
Thiobacillus denitrificans

Site:
position = -192
score = 5.91029
sequence = TACTGTATAAATCAACAGTA

Gene: Tbd_0830: Predicted RecA/RadA recombinase
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted RecA/RadA recombinase
imuB
 
Azoarcus sp. EbN1

Gene: ebA3079: DNA polymerase-like protein PA0670
 
Thauera sp. MZ1T

Gene: Tmz1t_2299: DNA polymerase-like protein PA0670
 
Dechloromonas aromatica RCB

Gene: Daro_1941: DNA polymerase-like protein PA0670
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_0829: DNA polymerase-like protein PA0670
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
DNA polymerase-like protein PA0670
dnaE2
 
Azoarcus sp. EbN1

Gene: ebA3077: DNA polymerase III alpha subunit (EC 2.7.7.7)
*
Thauera sp. MZ1T

Site:
position = -25
score = 5.83682
sequence = AACTGTATTTTTATACAGTC

Gene: Tmz1t_1948: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Dechloromonas aromatica RCB

Gene: Daro_1942: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_0828: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
DNA polymerase III alpha subunit (EC 2.7.7.7)
dnaQ
 
Azoarcus sp. EbN1

Gene: ebA4628: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Thauera sp. MZ1T

Gene: Tmz1t_3956: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Dechloromonas aromatica RCB

Gene: Daro_1907: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_0827: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Chromobacterium violaceum ATCC 12472

Gene: CV1020: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02526: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
CRON 2.
dinB
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
*
Dechloromonas aromatica RCB

Site:
position = -262
score = 5.95356
sequence = GGCTGTATATTTATACAGCC

Gene: Daro_2123: DNA polymerase IV (EC 2.7.7.7)
 
Nitrosomonas europaea ATCC 19718

Gene: NE1219: DNA polymerase IV (EC 2.7.7.7)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0949: DNA polymerase IV (EC 2.7.7.7)
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT

Gene: Mfla_0008: DNA polymerase IV (EC 2.7.7.7)
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
DNA polymerase IV (EC 2.7.7.7)
 
CRON 3.
uvrD
 
Azoarcus sp. EbN1
*
Thauera sp. MZ1T

Site:
position = -20
score = 5.37152
sequence = GGCTGAATATACTTACAGCC

Gene: Tmz1t_0548: ATP-dependent DNA helicase II
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
*
Thiobacillus denitrificans

Site:
position = -19
score = 6.49066
sequence = TACTGTATAAAAATACAGCA

Gene: Tbd_1306: ATP-dependent DNA helicase II
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
ATP-dependent DNA helicase II
 
CRON 4.
uvrA
 
Azoarcus sp. EbN1

Gene: ebA3857: Excinuclease ABC subunit A
 
Thauera sp. MZ1T

Gene: Tmz1t_3309: Excinuclease ABC subunit A
*
Dechloromonas aromatica RCB

Site:
position = -85
score = 6.15295
sequence = TGCTGTATAAAAAAACAGCC

Gene: Daro_0473: Excinuclease ABC subunit A
 
Nitrosomonas europaea ATCC 19718

Gene: NE2455: Excinuclease ABC subunit A
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2229: Excinuclease ABC subunit A
 
Thiobacillus denitrificans

Gene: Tbd_0436: Excinuclease ABC subunit A
 
Chromobacterium violaceum ATCC 12472

Gene: CV1893: Excinuclease ABC subunit A
 
Neisseria meningitidis MC58

Gene: NMB0962: Excinuclease ABC subunit A
 
Laribacter hongkongensis HLHK9

Gene: LHK_01605: Excinuclease ABC subunit A
 
Methylobacillus flagellatus KT

Gene: Mfla_2426: Excinuclease ABC subunit A
 
Methylotenera mobilis JLW8

Gene: Mmol_2133: Excinuclease ABC subunit A
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01620: Excinuclease ABC subunit A
Excinuclease ABC subunit A
 
CRON 5.
recA
 
Azoarcus sp. EbN1

Gene: ebA3396: Recombinase A
 
Thauera sp. MZ1T

Gene: Tmz1t_0711: Recombinase A
*
Dechloromonas aromatica RCB

Site:
position = -146
score = 5.81546
sequence = TACTGTATTTATACACAGTA

Gene: Daro_4152: Recombinase A
 
Nitrosomonas europaea ATCC 19718

Gene: NE1932: Recombinase A
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0019: Recombinase A
 
Thiobacillus denitrificans

Gene: Tbd_2197: Recombinase A
 
Chromobacterium violaceum ATCC 12472

Gene: CV1607: Recombinase A
 
Neisseria meningitidis MC58

Gene: NMB1445: Recombinase A
 
Laribacter hongkongensis HLHK9

Gene: LHK_00793: Recombinase A
 
Methylobacillus flagellatus KT

Gene: Mfla_0570: Recombinase A
 
Methylotenera mobilis JLW8

Gene: Mmol_1903: Recombinase A
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02395: Recombinase A
Recombinase A
recX
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T

Gene: Tmz1t_0710: Regulatory protein RecX
 
Dechloromonas aromatica RCB

Gene: Daro_4151: Regulatory protein RecX
 
Nitrosomonas europaea ATCC 19718

Gene: NE1931: Regulatory protein RecX
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0020: Regulatory protein RecX
 
Thiobacillus denitrificans

Gene: Tbd_2198: Regulatory protein RecX
 
Chromobacterium violaceum ATCC 12472

Gene: CV1606: Regulatory protein RecX
 
Neisseria meningitidis MC58

Gene: NMB1479: Regulatory protein RecX
 
Laribacter hongkongensis HLHK9

Gene: LHK_00794: Regulatory protein RecX
 
Methylobacillus flagellatus KT

Gene: Mfla_0569: Regulatory protein RecX
 
Methylotenera mobilis JLW8

Gene: Mmol_1904: Regulatory protein RecX
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02390: Regulatory protein RecX
Regulatory protein RecX
 
CRON 6.
ruvA
 
Azoarcus sp. EbN1

Gene: ebA3959: Holliday junction DNA helicase RuvA
 
Thauera sp. MZ1T

Gene: Tmz1t_3831: Holliday junction DNA helicase RuvA
*
Dechloromonas aromatica RCB

Site:
position = -47
score = 5.71081
sequence = AACTGTGTGAAAATACAGTA

Gene: Daro_4062: Holliday junction DNA helicase RuvA
 
Nitrosomonas europaea ATCC 19718

Gene: NE0212: Holliday junction DNA helicase RuvA
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2720: Holliday junction DNA helicase RuvA
 
Thiobacillus denitrificans

Gene: Tbd_2213: Holliday junction DNA helicase RuvA
 
Chromobacterium violaceum ATCC 12472

Gene: CV4223: Holliday junction DNA helicase RuvA
 
Neisseria meningitidis MC58

Gene: NMB0265: Holliday junction DNA helicase RuvA
 
Laribacter hongkongensis HLHK9

Gene: LHK_03111: Holliday junction DNA helicase RuvA
 
Methylobacillus flagellatus KT

Gene: Mfla_2353: Holliday junction DNA helicase RuvA
 
Methylotenera mobilis JLW8

Gene: Mmol_2086: Holliday junction DNA helicase RuvA
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01680: Holliday junction DNA helicase RuvA
Holliday junction DNA helicase RuvA
yhhT
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_4061: Putative membrane protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_2085: Putative membrane protein
 
Methylophilales bacterium HTCC2181
Putative membrane protein
ruvB
 
Azoarcus sp. EbN1

Gene: ebA3958: Holliday junction DNA helicase RuvB
 
Thauera sp. MZ1T

Gene: Tmz1t_3832: Holliday junction DNA helicase RuvB
 
Dechloromonas aromatica RCB

Gene: Daro_4060: Holliday junction DNA helicase RuvB
 
Nitrosomonas europaea ATCC 19718

Gene: NE0213: Holliday junction DNA helicase RuvB
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A2719: Holliday junction DNA helicase RuvB
 
Thiobacillus denitrificans

Gene: Tbd_2211: Holliday junction DNA helicase RuvB
 
Chromobacterium violaceum ATCC 12472

Gene: CV4215: Holliday junction DNA helicase RuvB
 
Neisseria meningitidis MC58

Gene: NMB1243: Holliday junction DNA helicase RuvB
 
Laribacter hongkongensis HLHK9

Gene: LHK_00086: Holliday junction DNA helicase RuvB
 
Methylobacillus flagellatus KT

Gene: Mfla_2344: Holliday junction DNA helicase RuvB
 
Methylotenera mobilis JLW8

Gene: Mmol_2084: Holliday junction DNA helicase RuvB
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01685: Holliday junction DNA helicase RuvB
Holliday junction DNA helicase RuvB
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD