Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 18 8
Acidovorax sp. JS42 12 6
Comamonas testosteroni KF-1 11 5
Delftia acidovorans SPH-1 9 5
Polaromonas naphthalenivorans CJ2 9 4
Polaromonas sp. JS666 13 7
Rhodoferax ferrireducens DSM 15236 11 6
Variovorax paradoxus S110 12 6
Verminephrobacter eiseniae EF01-2 3 3
Methylibium petroleiphilum PM1 14 8
Leptothrix cholodnii SP-6 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF04055
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -42
score = 6.10062
sequence = AACTGTATATTCATACAGTT

Gene: Aave_2176: DNA repair photolyase
*
Acidovorax sp. JS42

Site:
position = -23
score = 4.94001
sequence = TGCTGGATGAAATCACAGTA

Gene: Ajs_2803: DNA repair photolyase
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = 2
score = 5.55607
sequence = GACTGTATTTTTATACAGTT

Gene: Daci_2403: DNA repair photolyase
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -137
score = 5.29311
sequence = AACTGGGTATTTATCCAGTA

Gene: Bpro_3135: DNA repair photolyase
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -40
score = 5.86341
sequence = TACTGTGTAAACATACAGTA

Gene: Vapar_1693: DNA repair photolyase
 
Verminephrobacter eiseniae EF01-2
*
Methylibium petroleiphilum PM1

Site:
position = -33
score = 6.03826
sequence = TACTGTACAAAAATACAGTA

Gene: Mpe_A2509: DNA repair photolyase
*
Leptothrix cholodnii SP-6

Site:
position = -39
score = 5.13262
sequence = AACTGTATGCGCATACAGTT

Gene: Lcho_2079: DNA repair photolyase
DNA repair photolyase
 
CRON 2.
umuD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -10
score = 5.61772
sequence = TACTGGATGGATGTACAGTA

Gene: Bpro_4982: DNA polymerase V, subunit UmuD
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -10
score = 5.04356
sequence = TACTGTATGGATGATCAGTA

Gene: Rfer_4342: DNA polymerase V, subunit UmuD
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
*
Methylibium petroleiphilum PM1

Site:
position = -55
score = 5.33417
sequence = TACTGTATGGATGTACAGCA

Gene: Mpe_B0048: DNA polymerase V, subunit UmuD
 
Leptothrix cholodnii SP-6
DNA polymerase V, subunit UmuD
umuC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_4268: DNA polymerase V, subunit UmuC
 
Polaromonas sp. JS666

Gene: Bpro_4983: DNA polymerase V, subunit UmuC
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_4341: DNA polymerase V, subunit UmuC
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
*
Methylibium petroleiphilum PM1

Site:
position = -6
score = 5.80485
sequence = TACTGTATGTCCATACAGTA

Gene: Mpe_B0052: DNA polymerase V, subunit UmuC
 
Leptothrix cholodnii SP-6
DNA polymerase V, subunit UmuC
 
CRON 3.
parE
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -52
score = 4.08323
sequence = GGCTGTCTTTCCATCCAGTA

Gene: Aave_1340: Topoisomerase IV subunit B (EC 5.99.1.-)
*
Acidovorax sp. JS42

Site:
position = -35
score = 4.52777
sequence = TCCTGGTTTTATATCCAGCA

Gene: Ajs_1014: Topoisomerase IV subunit B (EC 5.99.1.-)
*
Comamonas testosteroni KF-1

Site:
position = -52
score = 4.38915
sequence = AACTGTGAATTTATCCAGCT

Gene: CtesDRAFT_5182: Topoisomerase IV subunit B (EC 5.99.1.-)
 
Delftia acidovorans SPH-1

Gene: Daci_5085: Topoisomerase IV subunit B (EC 5.99.1.-)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -64
score = 5.44231
sequence = AACTGTATGTTTGTACAGGT

Gene: Pnap_1199: Topoisomerase IV subunit B (EC 5.99.1.-)
*
Polaromonas sp. JS666

Site:
position = -114
score = 5.29311
sequence = AACTGGGTATTTATCCAGTA

Gene: Bpro_3165: Topoisomerase IV subunit B (EC 5.99.1.-)
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -38
score = 4.15904
sequence = AGCTGTGCTTTCATACAGCC

Gene: Rfer_2642: Topoisomerase IV subunit B (EC 5.99.1.-)
 
Variovorax paradoxus S110

Gene: Vapar_3428: Topoisomerase IV subunit B (EC 5.99.1.-)
*
Verminephrobacter eiseniae EF01-2

Site:
position = -52
score = 5.0162
sequence = AACTGTTTTTTTATCCAGCT

Gene: Veis_1664: Topoisomerase IV subunit B (EC 5.99.1.-)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2559: Topoisomerase IV subunit B (EC 5.99.1.-)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2635: Topoisomerase IV subunit B (EC 5.99.1.-)
Topoisomerase IV subunit B (EC 5.99.1.-)
yjbJ
 2
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0476: Conserved hypothetical protein, similar to lytic transglycosylase

Gene: Aave_1341: Conserved hypothetical protein, similar to lytic transglycosylase
 
Acidovorax sp. JS42

Gene: Ajs_1015: Conserved hypothetical protein, similar to lytic transglycosylase
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_5183: Conserved hypothetical protein, similar to lytic transglycosylase
 
Delftia acidovorans SPH-1

Gene: Daci_5084: Conserved hypothetical protein, similar to lytic transglycosylase
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1200: Conserved hypothetical protein, similar to lytic transglycosylase
 
Polaromonas sp. JS666

Gene: Bpro_3164: Conserved hypothetical protein, similar to lytic transglycosylase
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3427: Conserved hypothetical protein, similar to lytic transglycosylase
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Conserved hypothetical protein, similar to lytic transglycosylase
parC
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_1342: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Acidovorax sp. JS42

Gene: Ajs_1016: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_5184: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Delftia acidovorans SPH-1

Gene: Daci_5083: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1201: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Polaromonas sp. JS666

Gene: Bpro_3163: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2641: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Variovorax paradoxus S110

Gene: Vapar_3425: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_0399: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2558: Topoisomerase IV subunit A (EC 5.99.1.-)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2632: Topoisomerase IV subunit A (EC 5.99.1.-)
Topoisomerase IV subunit A (EC 5.99.1.-)
 
CRON 4.
imuA
*3
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -34
score = 5.37367
sequence = TGCTGTATATTTGAACAGTA

Gene: Aave_2670: Predicted RecA/RadA recombinase

Site:
position = -49
score = 5.88406
sequence = TACTGTTTATTCATACAGTG

Gene: Aave_0516: Predicted RecA/RadA recombinase

Site:
position = -43
score = 5.70279
sequence = TACTGTATAAATAATCAGTA

Gene: Aave_2734: Predicted RecA/RadA recombinase
*
Acidovorax sp. JS42

Site:
position = -85
score = 4.94001
sequence = TGCTGGATGAAATCACAGTA

Gene: Ajs_1965: Predicted RecA/RadA recombinase
*
Comamonas testosteroni KF-1

Site:
position = -35
score = 5.6394
sequence = GACTGTATATTTGTACAGTA

Gene: CtesDRAFT_1921: Predicted RecA/RadA recombinase
*
Delftia acidovorans SPH-1

Site:
position = -35
score = 5.84987
sequence = TGCTGTATATTCATACAGTA

Gene: Daci_4263: Predicted RecA/RadA recombinase
*
Polaromonas naphthalenivorans CJ2

Site:
position = -33
score = 6.03388
sequence = TACTGGTTATTCATACAGTA

Gene: Pnap_4894: Predicted RecA/RadA recombinase
*
Polaromonas sp. JS666

Site:
position = -56
score = 6.01672
sequence = TACTGTACATAAATACAGTA

Gene: Bpro_2386: Predicted RecA/RadA recombinase
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -48
score = 5.30853
sequence = TACTGTTGTTTTATACAGTT

Gene: Rfer_1225: Predicted RecA/RadA recombinase
*2
Variovorax paradoxus S110

Site:
position = -32
score = 6.38076
sequence = TACTGTATAAAAATACAGTT

Gene: Vapar_3206: Predicted RecA/RadA recombinase

Site:
position = -32
score = 5.52893
sequence = TACTGTTCATCCATACAGTA

Gene: Vapar_4538: Predicted RecA/RadA recombinase
 
Verminephrobacter eiseniae EF01-2
*2
Methylibium petroleiphilum PM1

Site:
position = -133
score = 5.2215
sequence = TACTGTATGCCCATACAGTC

Gene: Mpe_B0617: Predicted RecA/RadA recombinase

Site:
position = -44
score = 5.74657
sequence = TACTGTATTTATGTACAGTA

Gene: Mpe_A1534: Predicted RecA/RadA recombinase
*
Leptothrix cholodnii SP-6

Site:
position = -32
score = 5.56293
sequence = GACTGTATGAACATACAGTC

Gene: Lcho_2901: Predicted RecA/RadA recombinase
Predicted RecA/RadA recombinase
imuB
 3
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2671: DNA polymerase-like protein PA0670

Gene: Aave_0517: DNA polymerase-like protein PA0670

Gene: Aave_2733: DNA polymerase-like protein PA0670
 
Acidovorax sp. JS42

Gene: Ajs_1966: DNA polymerase-like protein PA0670
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1920: DNA polymerase-like protein PA0670
 
Delftia acidovorans SPH-1

Gene: Daci_4262: DNA polymerase-like protein PA0670
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_4895: DNA polymerase-like protein PA0670
 
Polaromonas sp. JS666

Gene: Bpro_2387: DNA polymerase-like protein PA0670
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1226: DNA polymerase-like protein PA0670
 2
Variovorax paradoxus S110

Gene: Vapar_3205: DNA polymerase-like protein PA0670

Gene: Vapar_4537: DNA polymerase-like protein PA0670
 
Verminephrobacter eiseniae EF01-2
 2
Methylibium petroleiphilum PM1

Gene: Mpe_B0618: DNA polymerase-like protein PA0670

Gene: Mpe_A1533: DNA polymerase-like protein PA0670
 
Leptothrix cholodnii SP-6

Gene: Lcho_2902: DNA polymerase-like protein PA0670
DNA polymerase-like protein PA0670
dnaE2
 3
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2672: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: Aave_0518: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: Aave_2732: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Acidovorax sp. JS42

Gene: Ajs_1967: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1919: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Delftia acidovorans SPH-1

Gene: Daci_4261: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_4896: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Polaromonas sp. JS666

Gene: Bpro_2388: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1227: DNA polymerase III alpha subunit (EC 2.7.7.7)
 2
Variovorax paradoxus S110

Gene: Vapar_3204: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: Vapar_4536: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Verminephrobacter eiseniae EF01-2
 2
Methylibium petroleiphilum PM1

Gene: Mpe_B0619: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: Mpe_A1532: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2903: DNA polymerase III alpha subunit (EC 2.7.7.7)
DNA polymerase III alpha subunit (EC 2.7.7.7)
Aave_0184
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -33
score = 4.75125
sequence = CACTGTATTTACAATCAGTG

Gene: Aave_0184: Conserved hypothetical protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1706: Conserved hypothetical protein
 
Polaromonas sp. JS666

Gene: Bpro_2305: Conserved hypothetical protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3203: Conserved hypothetical protein
 
Verminephrobacter eiseniae EF01-2
*
Methylibium petroleiphilum PM1

Site:
position = -49
score = 5.43999
sequence = TACTGTATTTACGAACAGTA

Gene: Mpe_A0910: Conserved hypothetical protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_0308: Conserved hypothetical protein
Conserved hypothetical protein
PF06733
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0185: DinG family ATP-dependent helicase CPE1197
 
Acidovorax sp. JS42

Gene: Ajs_2428: DinG family ATP-dependent helicase CPE1197
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_1894: DinG family ATP-dependent helicase CPE1197
 
Delftia acidovorans SPH-1

Gene: Daci_5813: DinG family ATP-dependent helicase CPE1197
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_1361: DinG family ATP-dependent helicase CPE1197
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -26
score = 4.9962
sequence = TACTGTTGTTTTATACAGCA

Gene: Vapar_2806: DinG family ATP-dependent helicase CPE1197
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0909: DinG family ATP-dependent helicase CPE1197
 
Leptothrix cholodnii SP-6
DinG family ATP-dependent helicase CPE1197
PF08774
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -75
score = 4.94001
sequence = TGCTGGATGAAATCACAGTA

Gene: Ajs_2429: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
*
Comamonas testosteroni KF-1

Site:
position = -6
score = 5.55904
sequence = AGCTGTATGAAAATACAGGT

Gene: CtesDRAFT_1895: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
*
Delftia acidovorans SPH-1

Site:
position = -54
score = 5.55406
sequence = GACTGTATAAAGATACAGTT

Gene: Daci_5814: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Hypothetical protein, restriction endonuclease-like VRR-NUC domain
 
CRON 5.
recA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -98
score = 4.30784
sequence = TACTGGTCAAGCATCCAGCC

Gene: Aave_4640: Recombinase A
*
Acidovorax sp. JS42

Site:
position = -87
score = 4.34851
sequence = TACTGTTCAAGCATCCAGCC

Gene: Ajs_4001: Recombinase A
*
Comamonas testosteroni KF-1

Site:
position = -76
score = 4.34851
sequence = TACTGTTCAAGCATCCAGCC

Gene: CtesDRAFT_3877: Recombinase A
*
Delftia acidovorans SPH-1

Site:
position = -66
score = 4.34851
sequence = TACTGTTCAAGCATCCAGCC

Gene: Daci_0874: Recombinase A
*
Polaromonas naphthalenivorans CJ2

Site:
position = -102
score = 4.41396
sequence = TACTGTTCATGCACCCAGTA

Gene: Pnap_3956: Recombinase A
*
Polaromonas sp. JS666

Site:
position = -146
score = 4.19855
sequence = AACTGACTAAAAATAGGGTT

Gene: Bpro_4685: Recombinase A
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -38
score = 4.34851
sequence = TACTGTTCAAGCATCCAGCC

Gene: Rfer_3948: Recombinase A
*
Variovorax paradoxus S110

Site:
position = -83
score = 4.34851
sequence = TACTGTTCAAGCATCCAGCC

Gene: Vapar_5195: Recombinase A
*
Verminephrobacter eiseniae EF01-2

Site:
position = -47
score = 4.56632
sequence = TACTGTTCAAGCATCCAGCT

Gene: Veis_0355: Recombinase A
*
Methylibium petroleiphilum PM1

Site:
position = -54
score = 5.28555
sequence = TACTGTACAAATAACCAGTT

Gene: Mpe_A0075: Recombinase A
*
Leptothrix cholodnii SP-6

Site:
position = -56
score = 4.81607
sequence = CACTGTACAAACATCCAGCA

Gene: Lcho_0497: Recombinase A
Recombinase A
recX
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4641: Regulatory protein RecX
 
Acidovorax sp. JS42

Gene: Ajs_4002: Regulatory protein RecX
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_3876: Regulatory protein RecX
 
Delftia acidovorans SPH-1

Gene: Daci_0873: Regulatory protein RecX
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3955: Regulatory protein RecX
 
Polaromonas sp. JS666

Gene: Bpro_4684: Regulatory protein RecX
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3947: Regulatory protein RecX
 
Variovorax paradoxus S110

Gene: Vapar_5194: Regulatory protein RecX
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0074: Regulatory protein RecX
 
Leptothrix cholodnii SP-6

Gene: Lcho_0496: Regulatory protein RecX
Regulatory protein RecX
 
CRON 6.
radA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0262: DNA repair protein RadA
 
Acidovorax sp. JS42

Gene: Ajs_0180: DNA repair protein RadA
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_3997: DNA repair protein RadA
 
Delftia acidovorans SPH-1

Gene: Daci_0314: DNA repair protein RadA
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0138: DNA repair protein RadA
*
Polaromonas sp. JS666

Site:
position = -30
score = 5.66058
sequence = TACTGGTTGTTTGTACAGTA

Gene: Bpro_0200: DNA repair protein RadA
*2
Rhodoferax ferrireducens DSM 15236

Site:
position = -31
score = 4.91177
sequence = ATCTGTTTTTCCATACAGTA

Gene: Rfer_0500: DNA repair protein RadA

Gene: Rfer_4298: DNA repair protein RadA
 
Variovorax paradoxus S110

Gene: Vapar_0251: DNA repair protein RadA
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_0797: DNA repair protein RadA
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3556: DNA repair protein RadA
 
Leptothrix cholodnii SP-6

Gene: Lcho_0917: DNA repair protein RadA
DNA repair protein RadA
 
CRON 7.
lexA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -95
score = 6.0591
sequence = AACTGTTTAAAAATACAGTG

Gene: Aave_2558: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Acidovorax sp. JS42

Site:
position = -54
score = 5.76961
sequence = TACTGGATTAAAAAACAGTA

Site:
position = -73
score = 5.50813
sequence = AACTGTTCAAAAATACAGAT

Gene: Ajs_2310: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Comamonas testosteroni KF-1

Site:
position = -67
score = 5.63136
sequence = AACTGATTAAAAATACAGGT

Site:
position = -48
score = 5.60636
sequence = TACTGGATGAACACACAGTA

Gene: CtesDRAFT_1157: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Delftia acidovorans SPH-1

Site:
position = -64
score = 4.72465
sequence = TACTGTATAAATCATCAGAT

Site:
position = -83
score = 5.82185
sequence = AACTGGTTAAAAATACAGAT

Gene: Daci_3565: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -84
score = 5.8947
sequence = TACTGGATATTCATACAGTC

Site:
position = -103
score = 5.54611
sequence = AGCTGTATAAAAATGCAGTT

Gene: Pnap_1918: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Polaromonas sp. JS666

Site:
position = -96
score = 5.66533
sequence = TACTGGATATTAAAACAGGT

Site:
position = -115
score = 6.11857
sequence = AACTGGATGAAAATACAGTT

Gene: Bpro_2954: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -65
score = 4.64268
sequence = TACTGAATACAACAACAGTG

Site:
position = -84
score = 5.91638
sequence = AACTGATTAAAAATACAGTT

Gene: Rfer_2994: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Variovorax paradoxus S110

Site:
position = -36
score = 4.94289
sequence = TACTGGATATTCAGCCAGTG

Site:
position = -55
score = 5.91202
sequence = AACTGGTTAAAAATACAGGT

Gene: Vapar_2636: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Verminephrobacter eiseniae EF01-2

Site:
position = -56
score = 5.5065
sequence = TACTGGATTGAAAAACAGTT

Site:
position = -75
score = 5.87282
sequence = AACTGGTTAAAAATACAGCT

Gene: Veis_4912: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Methylibium petroleiphilum PM1

Site:
position = -67
score = 5.42422
sequence = CACTGGATAAAAATTCAGTG

Site:
position = -86
score = 5.75456
sequence = AGCTGGATAAAAATACAGTC

Gene: Mpe_A1866: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Leptothrix cholodnii SP-6

Site:
position = -110
score = 5.37926
sequence = GACTGGATAAAATTACAGTG

Gene: Lcho_2082: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD