Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 75 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 9 7
Burkholderia mallei ATCC 23344 10 8
Burkholderia sp. 383 13 9
Burkholderia cepacia AMMD 14 9
Burkholderia vietnamiensis G4 21 12
Burkholderia glumae BGR1 14 8
Burkholderia xenovorans LB400 11 8
Burkholderia phymatum STM815 12 7
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF04055
*
Burkholderia pseudomallei K96243

Site:
position = -67
score = 6.26403
sequence = TACTGTATGTTTATACAGTA

Gene: BPSL2495: DNA repair photolyase
*
Burkholderia mallei ATCC 23344

Site:
position = -100
score = 6.26403
sequence = TACTGTATGTTTATACAGTA

Gene: BMA0406: DNA repair photolyase
*
Burkholderia sp. 383

Site:
position = -46
score = 6.38477
sequence = TACTGTATAAATGTACAGTA

Gene: Bcep18194_A4180: DNA repair photolyase
*
Burkholderia cepacia AMMD

Site:
position = -34
score = 6.49786
sequence = TACTGTATAAATATACAGTA

Gene: Bamb_0942: DNA repair photolyase
*
Burkholderia vietnamiensis G4

Site:
position = -34
score = 6.38477
sequence = TACTGTATAAATGTACAGTA

Gene: Bcep1808_0987: DNA repair photolyase
*
Burkholderia glumae BGR1

Site:
position = -67
score = 6.24294
sequence = TACTGTATAAATAAACAGTA

Gene: bglu_1g09000: DNA repair photolyase
*
Burkholderia xenovorans LB400

Site:
position = -54
score = 5.88439
sequence = CACTGTATATTTATACAGGT

Gene: Bxe_A1003: DNA repair photolyase
*
Burkholderia phymatum STM815

Site:
position = -25
score = 6.34699
sequence = CACTGTATATTTGTACAGTA

Gene: Bphy_0767: DNA repair photolyase
DNA repair photolyase
 
CRON 2.
PF10616
*
Burkholderia pseudomallei K96243

Site:
position = 10
score = 6.24992
sequence = TACTGTATATTCGTACAGTA

Gene: BPSS0003: Protein of unknown function DUF2471
*
Burkholderia mallei ATCC 23344

Site:
position = -92
score = 6.24992
sequence = TACTGTATATTCGTACAGTA

Gene: BMAA0003: Protein of unknown function DUF2471
*
Burkholderia sp. 383

Site:
position = -91
score = 6.15094
sequence = TACTGTATGTTTGTACAGTA

Gene: Bcep18194_B3181: Protein of unknown function DUF2471
*
Burkholderia cepacia AMMD

Site:
position = -89
score = 6.15094
sequence = TACTGTATGTTTGTACAGTA

Gene: Bamb_4970: Protein of unknown function DUF2471
*
Burkholderia vietnamiensis G4

Site:
position = -89
score = 6.15094
sequence = TACTGTATGTTTGTACAGTA

Gene: Bcep1808_3790: Protein of unknown function DUF2471
*
Burkholderia glumae BGR1

Site:
position = -42
score = 6.34699
sequence = CACTGTATATTTGTACAGTA

Gene: bglu_2g00070: Protein of unknown function DUF2471
*
Burkholderia xenovorans LB400

Site:
position = -43
score = 6.34699
sequence = CACTGTATATTTGTACAGTA

Gene: Bxe_B3023: Protein of unknown function DUF2471
*
Burkholderia phymatum STM815

Site:
position = -44
score = 6.15094
sequence = TACTGTATGTTTGTACAGTA

Gene: Bphy_4157: Protein of unknown function DUF2471
Protein of unknown function DUF2471
PF00589
 
Burkholderia pseudomallei K96243

Gene: BPSS0002: Predicted integrase/recombinase
 
Burkholderia mallei ATCC 23344

Gene: BMAA0002: Predicted integrase/recombinase
 
Burkholderia sp. 383

Gene: Bcep18194_B0001: Predicted integrase/recombinase
 
Burkholderia cepacia AMMD

Gene: Bamb_4969: Predicted integrase/recombinase
 2
Burkholderia vietnamiensis G4

Gene: Bcep1808_3791: Predicted integrase/recombinase

Gene: Bcep1808_7023: Predicted integrase/recombinase
 
Burkholderia glumae BGR1

Gene: bglu_2g00060: Predicted integrase/recombinase
 
Burkholderia xenovorans LB400

Gene: Bxe_B3024: Predicted integrase/recombinase
 
Burkholderia phymatum STM815

Gene: Bphy_4156: Predicted integrase/recombinase
Predicted integrase/recombinase
 
CRON 3.
uvrA
*
Burkholderia pseudomallei K96243

Site:
position = -143
score = 5.55415
sequence = AGCTGTATAAATATCCAGTA

Gene: BPSS0058: Excinuclease ABC subunit A
*
Burkholderia mallei ATCC 23344

Site:
position = -143
score = 5.55415
sequence = AGCTGTATAAATATCCAGTA

Gene: BMAA0062: Excinuclease ABC subunit A
*
Burkholderia sp. 383

Site:
position = -144
score = 6.18821
sequence = AACTGTATGAATATACAGTA

Gene: Bcep18194_C7351: Excinuclease ABC subunit A
*
Burkholderia cepacia AMMD

Site:
position = -57
score = 6.18821
sequence = AACTGTATGAATATACAGTA

Gene: Bamb_6248: Excinuclease ABC subunit A
*
Burkholderia vietnamiensis G4

Site:
position = -108
score = 6.07512
sequence = AACTGTATGAATGTACAGTA

Gene: Bcep1808_6497: Excinuclease ABC subunit A
*
Burkholderia glumae BGR1

Site:
position = -109
score = 5.79812
sequence = AGCTGTATGAATATACAGTA

Gene: bglu_2g07270: Excinuclease ABC subunit A
*
Burkholderia xenovorans LB400

Site:
position = -109
score = 6.05794
sequence = ACCTGTATAAATATACAGTA

Gene: Bxe_A3001: Excinuclease ABC subunit A
*
Burkholderia phymatum STM815

Site:
position = -73
score = 6.28719
sequence = AACTGTATAAACATACAGTA

Gene: Bphy_1549: Excinuclease ABC subunit A
Excinuclease ABC subunit A
 
CRON 4.
lexA
*
Burkholderia pseudomallei K96243

Site:
position = -45
score = 5.88308
sequence = TACTGTATAAAAATACAGCT

Site:
position = -25
score = 5.63132
sequence = CACTGTCTATCCATACAGTC

Gene: BPSL1840: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia mallei ATCC 23344

Site:
position = -45
score = 5.81055
sequence = TACTGTATAAAAATACAGAT

Site:
position = -25
score = 5.63132
sequence = CACTGTCTATCCATACAGTC

Gene: BMA1211: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia sp. 383

Site:
position = -45
score = 5.88308
sequence = TACTGTATAAAAATACAGCT

Site:
position = -25
score = 5.7587
sequence = CACTGTCTATCCATACAGTT

Gene: Bcep18194_A4738: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia cepacia AMMD

Site:
position = -45
score = 5.88308
sequence = TACTGTATAAAAATACAGCT

Site:
position = -25
score = 5.7587
sequence = CACTGTCTATCCATACAGTT

Gene: Bamb_1496: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia vietnamiensis G4

Site:
position = -45
score = 5.88308
sequence = TACTGTATAAAAATACAGCT

Site:
position = -25
score = 5.7587
sequence = CACTGTCTATCCATACAGTT

Gene: Bcep1808_1552: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia glumae BGR1

Site:
position = 15
score = 5.81055
sequence = TACTGTATAAAAATACAGAT

Gene: bglu_1g18740: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia xenovorans LB400

Site:
position = -45
score = 6.11388
sequence = TACTGTATAAAAATACAGTC

Site:
position = -25
score = 5.27449
sequence = ACCTGTTCATACATACAGTG

Gene: Bxe_A2471: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Burkholderia phymatum STM815

Site:
position = -45
score = 5.68317
sequence = TACTGTATAAAAATACAGGC

Site:
position = -25
score = 5.39212
sequence = ACCTGTCTATCCATACAGTG

Gene: Bphy_1630: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
 
CRON 5.
BPSS1334
*
Burkholderia pseudomallei K96243

Site:
position = -29
score = 5.69381
sequence = TACTGTATTTATGTCCAGTG

Gene: BPSS1334: Conserved hypothetical protein
*
Burkholderia mallei ATCC 23344

Site:
position = 22
score = 5.1041
sequence = TACTGGATAAATTAACAGTA

Gene: BMAA0943: Conserved hypothetical protein
*
Burkholderia sp. 383

Site:
position = -29
score = 5.88451
sequence = TACTGTATTTATGAACAGTG

Gene: Bcep18194_B1879: Conserved hypothetical protein
*
Burkholderia cepacia AMMD

Site:
position = -29
score = 5.28772
sequence = TACTGGATTTATGAACAGTG

Gene: Bamb_3559: Conserved hypothetical protein
*
Burkholderia vietnamiensis G4

Site:
position = -140
score = 5.00486
sequence = AGCTGTATAACCAACCAGTA

Gene: Bcep1808_4711: Conserved hypothetical protein
*
Burkholderia glumae BGR1

Site:
position = -31
score = 5.56884
sequence = CACTGTATTCATAAACAGTA

Gene: bglu_2g10090: Conserved hypothetical protein
*
Burkholderia xenovorans LB400

Site:
position = -44
score = 5.70088
sequence = TACTGTATAAATTAACAGTA

Gene: Bxe_A3818: Conserved hypothetical protein
 
Burkholderia phymatum STM815
Conserved hypothetical protein
 
CRON 6.
PF08774
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -30
score = 5.49932
sequence = ACCTGTACAAATGTACAGTG

Gene: Bcep18194_B1631: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
*
Burkholderia cepacia AMMD

Site:
position = -30
score = 5.39665
sequence = ACCTGTACAAACGTACAGTG

Gene: Bamb_3800: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
*
Burkholderia vietnamiensis G4

Site:
position = -30
score = 5.39665
sequence = ACCTGTACAAACGTACAGTG

Gene: Bcep1808_4916: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
 
Burkholderia glumae BGR1

Gene: bglu_2g11950: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
*
Burkholderia xenovorans LB400

Site:
position = -34
score = 5.8229
sequence = CACTGTATATACATACAGGT

Gene: Bxe_B1179: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
*
Burkholderia phymatum STM815

Site:
position = -37
score = 5.58714
sequence = GGCTGTATAAATATACAGTT

Gene: Bphy_5308: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Hypothetical protein, restriction endonuclease-like VRR-NUC domain
PF06733
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B1630: DinG family ATP-dependent helicase CPE1197
 
Burkholderia cepacia AMMD

Gene: Bamb_3801: DinG family ATP-dependent helicase CPE1197
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_4917: DinG family ATP-dependent helicase CPE1197
 
Burkholderia glumae BGR1

Gene: bglu_2g11940: DinG family ATP-dependent helicase CPE1197
 
Burkholderia xenovorans LB400

Gene: Bxe_B1180: DinG family ATP-dependent helicase CPE1197
 
Burkholderia phymatum STM815

Gene: Bphy_5309: DinG family ATP-dependent helicase CPE1197
DinG family ATP-dependent helicase CPE1197
 
CRON 7.
dinB
*
Burkholderia pseudomallei K96243

Site:
position = -28
score = 5.86667
sequence = CACTGTGTTTTTGTACAGTA

Gene: BPSL2306: DNA polymerase IV (EC 2.7.7.7)
*
Burkholderia mallei ATCC 23344

Site:
position = -28
score = 5.86667
sequence = CACTGTGTTTTTGTACAGTA

Gene: BMA1727: DNA polymerase IV (EC 2.7.7.7)
*
Burkholderia sp. 383

Site:
position = -28
score = 5.86667
sequence = CACTGTGTTTTTGTACAGTA

Gene: Bcep18194_A5448: DNA polymerase IV (EC 2.7.7.7)
*
Burkholderia cepacia AMMD

Site:
position = -4
score = 5.86667
sequence = CACTGTGTTTTTGTACAGTA

Gene: Bamb_2179: DNA polymerase IV (EC 2.7.7.7)
*
Burkholderia vietnamiensis G4

Site:
position = -28
score = 5.86667
sequence = CACTGTGTTTTTGTACAGTA

Gene: Bcep1808_2222: DNA polymerase IV (EC 2.7.7.7)
 
Burkholderia glumae BGR1

Gene: bglu_1g24860: DNA polymerase IV (EC 2.7.7.7)
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
DNA polymerase IV (EC 2.7.7.7)
 
CRON 8.
imuA
 
Burkholderia pseudomallei K96243
*
Burkholderia mallei ATCC 23344

Site:
position = -32
score = 6.2821
sequence = TACTGTATAAACGTACAGTA

Gene: BMA3143: Predicted RecA/RadA recombinase
*
Burkholderia sp. 383

Site:
position = -32
score = 6.06751
sequence = TACTGTATATCCATACAGTT

Gene: Bcep18194_A6158: Predicted RecA/RadA recombinase
*
Burkholderia cepacia AMMD

Site:
position = -32
score = 6.06751
sequence = TACTGTATATCCATACAGTT

Gene: Bamb_2888: Predicted RecA/RadA recombinase
*4
Burkholderia vietnamiensis G4

Site:
position = -32
score = 6.06751
sequence = TACTGTATATCCATACAGTT

Gene: Bcep1808_2932: Predicted RecA/RadA recombinase

Site:
position = -36
score = 5.70932
sequence = TACTGTATATCCATACAGCT

Gene: Bcep1808_6888: Predicted RecA/RadA recombinase

Site:
position = -34
score = 5.70932
sequence = TACTGTATATCCATACAGCT

Gene: Bcep1808_2009: Predicted RecA/RadA recombinase

Site:
position = -39
score = 5.94852
sequence = ACCTGTATATTTATACAGTG

Gene: Bcep1808_7144: Predicted RecA/RadA recombinase
*2
Burkholderia glumae BGR1

Site:
position = -32
score = 6.39519
sequence = TACTGTATAAACATACAGTA

Gene: bglu_1g31560: Predicted RecA/RadA recombinase

Site:
position = -166
score = 6.09003
sequence = GACTGTATATTTATACAGTA

Gene: bglu_4p0880: Predicted RecA/RadA recombinase
*
Burkholderia xenovorans LB400

Site:
position = -32
score = 6.21249
sequence = TACTGTATATCCATACAGTA

Gene: Bxe_A0227: Predicted RecA/RadA recombinase
*
Burkholderia phymatum STM815

Site:
position = -34
score = 6.35289
sequence = TACTGTATAAATATACAGTT

Gene: Bphy_1972: Predicted RecA/RadA recombinase
Predicted RecA/RadA recombinase
imuB
 
Burkholderia pseudomallei K96243

Gene: BPSL0471: DNA polymerase-like protein PA0670
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A6157: DNA polymerase-like protein PA0670
 
Burkholderia cepacia AMMD

Gene: Bamb_2887: DNA polymerase-like protein PA0670
 3
Burkholderia vietnamiensis G4

Gene: Bcep1808_2931: DNA polymerase-like protein PA0670

Gene: Bcep1808_2008: DNA polymerase-like protein PA0670

Gene: Bcep1808_7143: DNA polymerase-like protein PA0670
 2
Burkholderia glumae BGR1

Gene: bglu_1g31550: DNA polymerase-like protein PA0670

Gene: bglu_4p0890: DNA polymerase-like protein PA0670
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815

Gene: Bphy_1971: DNA polymerase-like protein PA0670
DNA polymerase-like protein PA0670
dnaE2
 
Burkholderia pseudomallei K96243

Gene: BPSL0472: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Burkholderia mallei ATCC 23344

Gene: BMA3145: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Burkholderia sp. 383

Gene: Bcep18194_A6156: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Burkholderia cepacia AMMD

Gene: Bamb_2886: DNA polymerase III alpha subunit (EC 2.7.7.7)
 3
Burkholderia vietnamiensis G4

Gene: Bcep1808_2930: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: Bcep1808_2007: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: Bcep1808_7142: DNA polymerase III alpha subunit (EC 2.7.7.7)
 2
Burkholderia glumae BGR1

Gene: bglu_1g31540: DNA polymerase III alpha subunit (EC 2.7.7.7)

Gene: bglu_4p0900: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815

Gene: Bphy_1970: DNA polymerase III alpha subunit (EC 2.7.7.7)
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 9.
recA
*
Burkholderia pseudomallei K96243

Site:
position = -108
score = 5.96148
sequence = CACTGTTTTTTTATACAGTG

Gene: BPSL0776: Recombinase A
*
Burkholderia mallei ATCC 23344

Site:
position = -108
score = 5.96148
sequence = CACTGTTTTTTTATACAGTG

Gene: BMA0272: Recombinase A
*
Burkholderia sp. 383

Site:
position = -121
score = 5.96148
sequence = CACTGTTTTTTTATACAGTG

Gene: Bcep18194_A5979: Recombinase A
*
Burkholderia cepacia AMMD

Site:
position = -93
score = 5.96148
sequence = CACTGTTTTTTTATACAGTG

Gene: Bamb_2699: Recombinase A
*
Burkholderia vietnamiensis G4

Site:
position = -93
score = 5.96148
sequence = CACTGTTTTTTTATACAGTG

Gene: Bcep1808_2763: Recombinase A
*
Burkholderia glumae BGR1

Site:
position = -98
score = 5.96148
sequence = CACTGTTTTTTTATACAGTG

Gene: bglu_1g29970: Recombinase A
*
Burkholderia xenovorans LB400

Site:
position = -112
score = 5.96707
sequence = TACTGTTTTTTTATACAGTG

Gene: Bxe_A0671: Recombinase A
*
Burkholderia phymatum STM815

Site:
position = -121
score = 5.96707
sequence = TACTGTTTTTTTATACAGTG

Gene: Bphy_0440: Recombinase A
Recombinase A
recX
 
Burkholderia pseudomallei K96243

Gene: BPSL0777: Regulatory protein RecX
 
Burkholderia mallei ATCC 23344

Gene: BMA0273: Regulatory protein RecX
 
Burkholderia sp. 383

Gene: Bcep18194_A5978: Regulatory protein RecX
 
Burkholderia cepacia AMMD

Gene: Bamb_2698: Regulatory protein RecX
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2762: Regulatory protein RecX
 
Burkholderia glumae BGR1

Gene: bglu_1g29960: Regulatory protein RecX
 
Burkholderia xenovorans LB400

Gene: Bxe_A0672: Regulatory protein RecX
 
Burkholderia phymatum STM815

Gene: Bphy_0441: Regulatory protein RecX
Regulatory protein RecX
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD