Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 91 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 9 7
Marinobacter aqueolei 12 9
Marinobacter sp. ELB17 10 7
Oceanobacter sp. RED65 10 7
Oceanospirillum sp. MED92 14 8
Marinomonas sp. MWYL1 14 11
Saccharophagus degradans 2-40 11 8
Teredinibacter turnerae T7901 10 8
Cellvibrio japonicus Ueda107 6 4
Chromohalobacter salexigens DSM 3043 6 4
Reinekea sp. MED297 12 9
Alcanivorax borkumensis SK2 9 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dnaQ
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
*
Oceanobacter sp. RED65

Site:
position = -41
score = 6.04088
sequence = TACTGTATATAAATACAGCT

Site:
position = -54
score = 5.12312
sequence = CACTTTATAAATATACTGTA

Gene: RED65_02924: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
CRON 2.
recA
*
Hahella chejuensis KCTC 2396

Site:
position = -76
score = 5.18281
sequence = TGCTGTCAATTTATACAGTA

Gene: HCH_05232: Recombinase A
*
Marinobacter aqueolei

Site:
position = -108
score = 5.74382
sequence = TACTGTTCAAATATACAGGA

Gene: Maqu_2082: Recombinase A
*
Marinobacter sp. ELB17

Site:
position = -142
score = 5.25952
sequence = TGCTGGTTAAATATACAGTG

Gene: MELB17_08004: Recombinase A
*
Oceanobacter sp. RED65

Site:
position = -102
score = 5.32111
sequence = TACTGGTTAAATTTACAGTG

Gene: RED65_07869: Recombinase A
*
Oceanospirillum sp. MED92

Site:
position = -61
score = 5.70033
sequence = TACTGTCCATACATACAGTA

Gene: MED92_08116: Recombinase A
*
Marinomonas sp. MWYL1

Site:
position = -87
score = 5.95242
sequence = TACTGTTTTTATATACAGTA

Gene: Mmwyl1_3732: Recombinase A
*
Saccharophagus degradans 2-40

Site:
position = -163
score = 5.17812
sequence = TACTGTATAAAAAACTATTA

Gene: Sde_1288: Recombinase A
*
Teredinibacter turnerae T7901

Site:
position = -242
score = 5.3243
sequence = CACTGTTTACACGTACAGTA

Gene: TERTU_2823: Recombinase A
*
Cellvibrio japonicus Ueda107

Site:
position = -126
score = 5.1653
sequence = CACTGTATAAATTACTAGTA

Gene: CJA_2230: Recombinase A
*
Chromohalobacter salexigens DSM 3043

Site:
position = -90
score = 4.95888
sequence = TACTGGCTAGTCATACAGTA

Gene: Csal_0623: Recombinase A
*
Reinekea sp. MED297

Site:
position = -31
score = 4.98751
sequence = TACTGGTCATTCATACAGCA

Gene: MED297_13572: Recombinase A
*
Alcanivorax borkumensis SK2

Site:
position = -109
score = 4.34463
sequence = TACTGTCCATAACGCCAGTG

Gene: ABO_1801: Recombinase A
Recombinase A
recX
 
Hahella chejuensis KCTC 2396

Gene: HCH_02189: Regulatory protein RecX
 
Marinobacter aqueolei

Gene: Maqu_2486: Regulatory protein RecX
 
Marinobacter sp. ELB17

Gene: MELB17_16123: Regulatory protein RecX
 
Oceanobacter sp. RED65

Gene: RED65_07864: Regulatory protein RecX
 
Oceanospirillum sp. MED92

Gene: MED92_08121: Regulatory protein RecX
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_3631: Regulatory protein RecX
 
Saccharophagus degradans 2-40

Gene: Sde_1289: Regulatory protein RecX
 
Teredinibacter turnerae T7901

Gene: TERTU_2821: Regulatory protein RecX
 
Cellvibrio japonicus Ueda107

Gene: CJA_2228: Regulatory protein RecX
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0624: Regulatory protein RecX
 
Reinekea sp. MED297

Gene: MED297_13577: Regulatory protein RecX
 
Alcanivorax borkumensis SK2

Gene: ABO_1800: Regulatory protein RecX
Regulatory protein RecX
 
CRON 3.
imuA
*
Hahella chejuensis KCTC 2396

Site:
position = -62
score = 5.45802
sequence = TACTGATTTTATATACAGTA

Gene: HCH_02202: Predicted RecA/RadA recombinase
*
Marinobacter aqueolei

Site:
position = -34
score = 6.53147
sequence = TACTGTATATATAAACAGTA

Gene: Maqu_0975: Predicted RecA/RadA recombinase
*
Marinobacter sp. ELB17

Site:
position = -35
score = 6.53147
sequence = TACTGTATATATAAACAGTA

Gene: MELB17_15581: Predicted RecA/RadA recombinase
*
Oceanobacter sp. RED65

Site:
position = -38
score = 6.58301
sequence = TACTGTATATATATACAGTA

Gene: RED65_01690: Predicted RecA/RadA recombinase
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -38
score = 5.69906
sequence = TACTGTATAGACATACAGCA

Gene: Sde_1030: Predicted RecA/RadA recombinase
*
Teredinibacter turnerae T7901

Site:
position = -37
score = 6.16717
sequence = TACTGTATATTAATACAGTT

Gene: TERTU_2925: Predicted RecA/RadA recombinase
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -35
score = 6.33719
sequence = TACTGTATATACATACAGTT

Gene: MED297_04849: Predicted RecA/RadA recombinase
 
Alcanivorax borkumensis SK2
Predicted RecA/RadA recombinase
imuB
 
Hahella chejuensis KCTC 2396

Gene: HCH_02201: DNA polymerase-like protein PA0670
 
Marinobacter aqueolei

Gene: Maqu_0974: DNA polymerase-like protein PA0670
 
Marinobacter sp. ELB17

Gene: MELB17_15586: DNA polymerase-like protein PA0670
 
Oceanobacter sp. RED65

Gene: RED65_01685: DNA polymerase-like protein PA0670
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1029: DNA polymerase-like protein PA0670
 
Teredinibacter turnerae T7901

Gene: TERTU_2926: DNA polymerase-like protein PA0670
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_04854: DNA polymerase-like protein PA0670
 
Alcanivorax borkumensis SK2
DNA polymerase-like protein PA0670
dnaE2
 
Hahella chejuensis KCTC 2396

Gene: HCH_02200: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Marinobacter aqueolei

Gene: Maqu_0973: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Marinobacter sp. ELB17

Gene: MELB17_15591: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Oceanobacter sp. RED65

Gene: RED65_01680: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1028: DNA polymerase III alpha subunit (EC 2.7.7.7)
*
Teredinibacter turnerae T7901

Site:
position = -30
score = 5.852
sequence = AACTGTATATTTAAACAGCA

Gene: TERTU_2929: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_04859: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Alcanivorax borkumensis SK2
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 4.
Sde_0008
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_0008: Conserved hypothetical protein
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_2697: Conserved hypothetical protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -40
score = 4.29608
sequence = CACTGACCATAAGAACAGTC

Gene: ABO_0311: Conserved hypothetical protein
Conserved hypothetical protein
recN
*
Hahella chejuensis KCTC 2396

Site:
position = -41
score = 5.84176
sequence = AACTGTATATATAGACAGTC

Gene: HCH_01222: DNA repair protein RecN
*
Marinobacter aqueolei

Site:
position = -62
score = 5.81245
sequence = CACTGTATGAAAAAACAGTA

Gene: Maqu_3364: DNA repair protein RecN
*
Marinobacter sp. ELB17

Site:
position = -46
score = 5.81245
sequence = CACTGTATGAAAAAACAGTA

Gene: MELB17_03505: DNA repair protein RecN
*
Oceanobacter sp. RED65

Site:
position = -70
score = 5.86093
sequence = TACTGTATAAATAAACATAT

Gene: RED65_13487: DNA repair protein RecN
*
Oceanospirillum sp. MED92

Site:
position = -28
score = 5.26215
sequence = CACTGTATAAAAACACATGT

Gene: MED92_07346: DNA repair protein RecN
*
Marinomonas sp. MWYL1

Site:
position = -50
score = 5.56975
sequence = TACTGTATAAATAACCATAT

Gene: Mmwyl1_3966: DNA repair protein RecN
*
Saccharophagus degradans 2-40

Site:
position = -43
score = 5.22627
sequence = CACTGTATAAATAACCATAC

Gene: Sde_2735: DNA repair protein RecN
*
Teredinibacter turnerae T7901

Site:
position = -65
score = 5.5637
sequence = TACTGTATAAATAGCCAATA

Gene: TERTU_3298: DNA repair protein RecN
*
Cellvibrio japonicus Ueda107

Site:
position = -49
score = 5.82528
sequence = TACTGTATAAACAGACAGAT

Gene: CJA_3351: DNA repair protein RecN
*
Chromohalobacter salexigens DSM 3043

Site:
position = -52
score = 5.70109
sequence = TACTGTATAAACACACAGAG

Gene: Csal_3096: DNA repair protein RecN
*
Reinekea sp. MED297

Site:
position = -82
score = 5.76114
sequence = AACTGTATATATATACATAT

Gene: MED297_09676: DNA repair protein RecN
 
Alcanivorax borkumensis SK2

Gene: ABO_0310: DNA repair protein RecN
DNA repair protein RecN
 
CRON 5.
lexA
*
Hahella chejuensis KCTC 2396

Site:
position = -82
score = 5.82207
sequence = TACTGTATACATAAACAGAC

Gene: HCH_02068: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Marinobacter aqueolei

Site:
position = -42
score = 5.90997
sequence = CACTGTATAAAAAAACAGGA

Gene: Maqu_2007: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Marinobacter sp. ELB17

Site:
position = -47
score = 5.634
sequence = CACTGTATAAACAAACAGGG

Gene: MELB17_18189: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Oceanobacter sp. RED65

Site:
position = -65
score = 5.22393
sequence = TACTTTACATACATACAGCA

Site:
position = -30
score = 5.3385
sequence = CTCTGTATATAAAAACAGAT

Gene: RED65_00670: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Oceanospirillum sp. MED92

Site:
position = -87
score = 5.81849
sequence = CACTGTATAAAAAAACATTA

Site:
position = -28
score = 5.88033
sequence = TACTGTATAAACAACCAGAA

Gene: MED92_03977: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Marinomonas sp. MWYL1

Site:
position = -44
score = 5.78284
sequence = TGCTGTATATAATAACAGTA

Gene: Mmwyl1_2117: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Saccharophagus degradans 2-40

Site:
position = -41
score = 5.33276
sequence = TACTGTATATTCATCCAATC

Gene: Sde_1787: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Teredinibacter turnerae T7901

Site:
position = -75
score = 6.06159
sequence = TACTGTATAAACAAACAGAT

Gene: TERTU_1938: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Cellvibrio japonicus Ueda107

Site:
position = -32
score = 5.90669
sequence = AACTGTATAAATACACAGAA

Gene: CJA_1697: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Chromohalobacter salexigens DSM 3043

Site:
position = -40
score = 4.83154
sequence = TACTGTATACTTGAACACGT

Gene: Csal_2070: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Reinekea sp. MED297

Site:
position = -28
score = 5.75335
sequence = TACTGTATATATTAACAGGC

Gene: MED297_16754: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Alcanivorax borkumensis SK2

Site:
position = -181
score = 4.20448
sequence = CACTGTTCTTATTGTCAGTA

Gene: ABO_1009: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
sulA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_2006: Cell division inhibitor sulA
 
Marinobacter sp. ELB17

Gene: MELB17_18184: Cell division inhibitor sulA
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_03972: Cell division inhibitor sulA
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1786: Cell division inhibitor sulA
 
Teredinibacter turnerae T7901

Gene: TERTU_1937: Cell division inhibitor sulA
 
Cellvibrio japonicus Ueda107

Gene: CJA_1696: Cell division inhibitor sulA
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -30
score = 5.67469
sequence = TACTGTTTATTTATACAGGC

Gene: MED297_16639: Cell division inhibitor sulA
 
Alcanivorax borkumensis SK2
Cell division inhibitor sulA
dinB
 
Hahella chejuensis KCTC 2396

Gene: HCH_04322: DNA polymerase IV (EC 2.7.7.7)
*
Marinobacter aqueolei

Site:
position = -41
score = 5.06033
sequence = GGCTGTATAAACGTACAGAT

Gene: Maqu_2332: DNA polymerase IV (EC 2.7.7.7)
*
Marinobacter sp. ELB17

Site:
position = -98
score = 4.74778
sequence = GGCTGTATGCATATACAGCG

Gene: MELB17_18524: DNA polymerase IV (EC 2.7.7.7)
*
Oceanobacter sp. RED65

Site:
position = -28
score = 5.73513
sequence = CACTGTATGTTAATACAGTA

Gene: RED65_10319: DNA polymerase IV (EC 2.7.7.7)
*
Oceanospirillum sp. MED92

Site:
position = -23
score = 6.48342
sequence = TACTGTATAAATAAACAGTA

Gene: MED92_14483: DNA polymerase IV (EC 2.7.7.7)
*
Marinomonas sp. MWYL1

Site:
position = -37
score = 5.30042
sequence = AACTGTGTTTTTATACAGTA

Gene: Mmwyl1_3784: DNA polymerase IV (EC 2.7.7.7)
 
Saccharophagus degradans 2-40

Gene: Sde_2507: DNA polymerase IV (EC 2.7.7.7)
*
Teredinibacter turnerae T7901

Site:
position = -68
score = 6.02968
sequence = AACTGTATAATAATACAGTA

Gene: TERTU_0718: DNA polymerase IV (EC 2.7.7.7)
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2071: DNA polymerase IV (EC 2.7.7.7)
*
Reinekea sp. MED297

Site:
position = -28
score = 5.38738
sequence = AACTGTATAAGCATACAGGT

Gene: MED297_03315: DNA polymerase IV (EC 2.7.7.7)
 
Alcanivorax borkumensis SK2

Gene: ABO_0659: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 6.
yebG
*
Hahella chejuensis KCTC 2396

Site:
position = -42
score = 5.54789
sequence = AACTGTATGAATATACAGAG

Gene: HCH_05148: SOS regulon DNA damage-inducible protein
*
Marinobacter aqueolei

Site:
position = -88
score = 6.05806
sequence = TACTGTATAAATATACACTA

Gene: Maqu_2961: SOS regulon DNA damage-inducible protein
*
Marinobacter sp. ELB17

Site:
position = -120
score = 6.06302
sequence = AACTGTATATATAAACAGTG

Gene: MELB17_11410: SOS regulon DNA damage-inducible protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -42
score = 6.20674
sequence = AACTGTATATTTATACAGTA

Gene: Mmwyl1_3691: SOS regulon DNA damage-inducible protein
*
Saccharophagus degradans 2-40

Site:
position = -46
score = 5.27588
sequence = TACTGTATACTCGTACAGCA

Gene: Sde_0674: SOS regulon DNA damage-inducible protein
*
Teredinibacter turnerae T7901

Site:
position = -88
score = 6.03377
sequence = TACTGTACAAACAAACAGTA

Gene: TERTU_0430: SOS regulon DNA damage-inducible protein
 
Cellvibrio japonicus Ueda107

Gene: CJA_3220: SOS regulon DNA damage-inducible protein
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
SOS regulon DNA damage-inducible protein
 
CRON 7.
uvrD
*
Hahella chejuensis KCTC 2396

Site:
position = -252
score = 4.97621
sequence = GGCTGTAAAATTATCCAGTA

Gene: HCH_00743: ATP-dependent DNA helicase II
*
Marinobacter aqueolei

Site:
position = -20
score = 4.97272
sequence = GGCTGTAAATTTAACCAGTA

Gene: Maqu_3642: ATP-dependent DNA helicase II
*
Marinobacter sp. ELB17

Site:
position = -30
score = 5.23542
sequence = ACCTGTTTATTTAACCAGTA

Gene: MELB17_02090: ATP-dependent DNA helicase II
 
Oceanobacter sp. RED65

Gene: RED65_15392: ATP-dependent DNA helicase II
*
Oceanospirillum sp. MED92

Site:
position = -34
score = 5.21094
sequence = CACTGATTATTTATACAGTG

Gene: MED92_05258: ATP-dependent DNA helicase II
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4444: ATP-dependent DNA helicase II
*
Saccharophagus degradans 2-40

Site:
position = -61
score = 4.94092
sequence = TGCTGTCTATTTATACATGT

Gene: Sde_3764: ATP-dependent DNA helicase II
 
Teredinibacter turnerae T7901

Gene: TERTU_4660: ATP-dependent DNA helicase II
 
Cellvibrio japonicus Ueda107

Gene: CJA_3566: ATP-dependent DNA helicase II
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3271: ATP-dependent DNA helicase II
*
Reinekea sp. MED297

Site:
position = -27
score = 5.06993
sequence = CCCTGTTTTTTTATACAGTT

Gene: MED297_19917: ATP-dependent DNA helicase II
 
Alcanivorax borkumensis SK2

Gene: ABO_2690: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 8.
ruvC
 
Hahella chejuensis KCTC 2396

Gene: HCH_04924: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Marinobacter aqueolei

Gene: Maqu_1706: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Marinobacter sp. ELB17

Gene: MELB17_14703: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -30
score = 5.49555
sequence = GCCTGTATAAATAACCAGTA

Gene: MED92_08737: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
*
Marinomonas sp. MWYL1

Site:
position = -43
score = 4.99567
sequence = GGCTGTTGAAATATACAGTA

Gene: Mmwyl1_2188: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Saccharophagus degradans 2-40

Gene: Sde_2535: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Teredinibacter turnerae T7901

Gene: TERTU_3436: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Cellvibrio japonicus Ueda107

Gene: CJA_1029: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1846: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Reinekea sp. MED297

Gene: MED297_13812: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Alcanivorax borkumensis SK2

Gene: ABO_0751: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
MED92_08742
 
Hahella chejuensis KCTC 2396

Gene: HCH_06086: Predicted inner membrane protein
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_08742: Predicted inner membrane protein
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0350: Predicted inner membrane protein
 
Reinekea sp. MED297

Gene: MED297_13817: Predicted inner membrane protein
 
Alcanivorax borkumensis SK2
Predicted inner membrane protein
ruvA
 
Hahella chejuensis KCTC 2396

Gene: HCH_04923: Holliday junction DNA helicase RuvA
 
Marinobacter aqueolei

Gene: Maqu_1705: Holliday junction DNA helicase RuvA
 
Marinobacter sp. ELB17

Gene: MELB17_14698: Holliday junction DNA helicase RuvA
*
Oceanobacter sp. RED65

Site:
position = -51
score = 5.32986
sequence = CACTGATTAAATTTACAGTA

Gene: RED65_05144: Holliday junction DNA helicase RuvA
 
Oceanospirillum sp. MED92

Gene: MED92_08747: Holliday junction DNA helicase RuvA
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2189: Holliday junction DNA helicase RuvA
 
Saccharophagus degradans 2-40

Gene: Sde_2534: Holliday junction DNA helicase RuvA
 
Teredinibacter turnerae T7901

Gene: TERTU_3435: Holliday junction DNA helicase RuvA
 
Cellvibrio japonicus Ueda107

Gene: CJA_1030: Holliday junction DNA helicase RuvA
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1847: Holliday junction DNA helicase RuvA
 
Reinekea sp. MED297

Gene: MED297_13822: Holliday junction DNA helicase RuvA
 
Alcanivorax borkumensis SK2

Gene: ABO_0752: Holliday junction DNA helicase RuvA
Holliday junction DNA helicase RuvA
ruvB
 
Hahella chejuensis KCTC 2396

Gene: HCH_04922: Holliday junction DNA helicase RuvB
 
Marinobacter aqueolei

Gene: Maqu_1704: Holliday junction DNA helicase RuvB
 
Marinobacter sp. ELB17

Gene: MELB17_14693: Holliday junction DNA helicase RuvB
 
Oceanobacter sp. RED65

Gene: RED65_05149: Holliday junction DNA helicase RuvB
 
Oceanospirillum sp. MED92

Gene: MED92_08752: Holliday junction DNA helicase RuvB
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2190: Holliday junction DNA helicase RuvB
 
Saccharophagus degradans 2-40

Gene: Sde_2533: Holliday junction DNA helicase RuvB
 
Teredinibacter turnerae T7901

Gene: TERTU_3434: Holliday junction DNA helicase RuvB
 
Cellvibrio japonicus Ueda107

Gene: CJA_1031: Holliday junction DNA helicase RuvB
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1848: Holliday junction DNA helicase RuvB
 
Reinekea sp. MED297

Gene: MED297_13827: Holliday junction DNA helicase RuvB
 
Alcanivorax borkumensis SK2

Gene: ABO_0753: Holliday junction DNA helicase RuvB
Holliday junction DNA helicase RuvB
 
CRON 9.
umuD
 
Hahella chejuensis KCTC 2396
*
Marinobacter aqueolei

Site:
position = -33
score = 6.21868
sequence = TACTGTATATTCAAACAGTA

Gene: Maqu_1208: DNA polymerase V, subunit UmuD
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -34
score = 6.454
sequence = TACTGTATATAAATACAGTA

Gene: MED92_07246: DNA polymerase V, subunit UmuD
*2
Marinomonas sp. MWYL1

Site:
position = -35
score = 6.02799
sequence = TACTGTATATCTATACAGTA

Gene: Mmwyl1_1981: DNA polymerase V, subunit UmuD

Site:
position = -34
score = 5.62457
sequence = TACTGTACGAATATACAGTC

Gene: Mmwyl1_2469: DNA polymerase V, subunit UmuD
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = 20
score = 5.3988
sequence = TACTGTACATATAGGCAGTA

Gene: ABO_1583: DNA polymerase V, subunit UmuD
DNA polymerase V, subunit UmuD
umuC
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_07251: DNA polymerase V, subunit UmuC
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1982: DNA polymerase V, subunit UmuC
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1582: DNA polymerase V, subunit UmuC
DNA polymerase V, subunit UmuC
 
CRON 10.
PF04055
*
Hahella chejuensis KCTC 2396

Site:
position = -35
score = 6.04081
sequence = TACTGTACATTTAAACAGTA

Gene: HCH_05408: DNA repair photolyase
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -34
score = 6.0475
sequence = TACTGTTTATATATACAGCA

Gene: Mmwyl1_0398: DNA repair photolyase
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
*
Cellvibrio japonicus Ueda107

Site:
position = 97
score = 5.70385
sequence = TACTGTATATGCATACAGAT

Gene: CJA_3708: DNA repair photolyase
*
Chromohalobacter salexigens DSM 3043

Site:
position = -34
score = 5.58753
sequence = TACTGGCTATAAATACAGTA

Gene: Csal_1500: DNA repair photolyase
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -29
score = 5.80435
sequence = TACTGTACAAAAAGACAGTA

Gene: ABO_1594: DNA repair photolyase
DNA repair photolyase
 
CRON 11.
intIA
 
Hahella chejuensis KCTC 2396
*
Marinobacter aqueolei

Site:
position = -37
score = 5.89354
sequence = TACTGTATATTTATACATAA

Gene: Maqu_0977: Integron integrase IntI4
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -36
score = 5.90898
sequence = TACTGTATATATAAACATAT

Gene: Sde_0425: Integron integrase IntI4
*
Teredinibacter turnerae T7901

Site:
position = -32
score = 5.94306
sequence = TACTGTATGTACAAACAGTT

Gene: TERTU_1758: Integron integrase IntI4
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -45
score = 5.91247
sequence = TACTGTATAAATATACATAT

Gene: MED297_04517: Integron integrase IntI4
 
Alcanivorax borkumensis SK2
Integron integrase IntI4
 
CRON 12.
topB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_2529: DNA topoisomerase III (EC 5.99.1.2)
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -26
score = 5.68333
sequence = TACTGTTTTTATATACAGTG

Gene: MED92_11029: DNA topoisomerase III (EC 5.99.1.2)
*
Marinomonas sp. MWYL1

Site:
position = -29
score = 6.53147
sequence = TACTGTATATATAAACAGTA

Gene: Mmwyl1_3275: DNA topoisomerase III (EC 5.99.1.2)
*
Saccharophagus degradans 2-40

Site:
position = -30
score = 5.34802
sequence = AGCTGTATATAACAACAGTA

Gene: Sde_1542: DNA topoisomerase III (EC 5.99.1.2)
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2146: DNA topoisomerase III (EC 5.99.1.2)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
DNA topoisomerase III (EC 5.99.1.2)
 
CRON 13.
uvrA
 
Hahella chejuensis KCTC 2396

Gene: HCH_06191: Excinuclease ABC subunit A
 
Marinobacter aqueolei

Gene: Maqu_0746: Excinuclease ABC subunit A
 
Marinobacter sp. ELB17

Gene: MELB17_20071: Excinuclease ABC subunit A
 
Oceanobacter sp. RED65

Gene: RED65_16506: Excinuclease ABC subunit A
 
Oceanospirillum sp. MED92

Gene: MED92_18383: Excinuclease ABC subunit A
*
Marinomonas sp. MWYL1

Site:
position = -73
score = 5.68753
sequence = TACTGTAAAAATAGACAGTT

Gene: Mmwyl1_4249: Excinuclease ABC subunit A
 
Saccharophagus degradans 2-40

Gene: Sde_0993: Excinuclease ABC subunit A
 
Teredinibacter turnerae T7901

Gene: TERTU_0942: Excinuclease ABC subunit A
 
Cellvibrio japonicus Ueda107

Gene: CJA_0726: Excinuclease ABC subunit A
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0448: Excinuclease ABC subunit A
*
Reinekea sp. MED297

Site:
position = -188
score = 5.68951
sequence = GACTGTACACATATACAGTA

Gene: MED297_12852: Excinuclease ABC subunit A
*
Alcanivorax borkumensis SK2

Site:
position = -43
score = 4.69752
sequence = CCCTGTTCATTTTGACAGTA

Gene: ABO_0427: Excinuclease ABC subunit A
Excinuclease ABC subunit A
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD