Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 77 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 9 8
Psychromonas sp. CNPT3 13 11
Moritella sp. PE36 13 12
Aeromonas hydrophila subsp. hydrophila ATCC 7966 13 11
Aeromonas salmonicida subsp. salmonicida A449 12 10
Tolumonas auensis DSM 9187 10 8
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ruvA
*
Psychromonas ingrahamii 37

Site:
position = -64
score = 5.31575
sequence = TACTGGATATTTACTCAGTT

Gene: Ping_0718: Holliday junction DNA helicase RuvA
*
Psychromonas sp. CNPT3

Site:
position = -64
score = 5.19926
sequence = CACTGGATATAAAGTCAGTT

Gene: PCNPT3_11040: Holliday junction DNA helicase RuvA
*
Moritella sp. PE36

Site:
position = -74
score = 5.30012
sequence = ATCTGGATATTTAACCAGTA

Gene: PE36_02589: Holliday junction DNA helicase RuvA
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -74
score = 5.11309
sequence = TGCTGGATACTTATCCAGTT

Gene: AHA_3648: Holliday junction DNA helicase RuvA
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -74
score = 5.11309
sequence = TGCTGGATACTTATCCAGTT

Gene: ASA_0735: Holliday junction DNA helicase RuvA
*
Tolumonas auensis DSM 9187

Site:
position = -63
score = 5.21364
sequence = AACTGGATGTTCATCCAGTT

Gene: Tola_2712: Holliday junction DNA helicase RuvA
Holliday junction DNA helicase RuvA
ruvB
 
Psychromonas ingrahamii 37

Gene: Ping_0719: Holliday junction DNA helicase RuvB
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11035: Holliday junction DNA helicase RuvB
 
Moritella sp. PE36

Gene: PE36_02584: Holliday junction DNA helicase RuvB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3647: Holliday junction DNA helicase RuvB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0736: Holliday junction DNA helicase RuvB
 
Tolumonas auensis DSM 9187

Gene: Tola_2711: Holliday junction DNA helicase RuvB
Holliday junction DNA helicase RuvB
 
CRON 2.
lexA
*
Psychromonas ingrahamii 37

Site:
position = -43
score = 4.90492
sequence = CACTGTTCATGTTTACAGTT

Site:
position = -58
score = 4.56693
sequence = CCATGTATGAATATACACTG

Gene: Ping_0108: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Psychromonas sp. CNPT3

Site:
position = -37
score = 5.57942
sequence = CACTGTCTATATTAACAGTT

Site:
position = -52
score = 4.5492
sequence = CCATGTATAGATATACACTG

Gene: PCNPT3_02010: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Moritella sp. PE36

Site:
position = -30
score = 5.90841
sequence = AACTGTATATAAAACCAGTT

Site:
position = -50
score = 5.19063
sequence = TACTGTATATAATTACAAGA

Gene: PE36_16374: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -29
score = 5.28587
sequence = TGCTGTATAAAAAGACAGGT

Site:
position = -49
score = 5.29087
sequence = CACTGTATATACTGCCAGTG

Gene: AHA_0183: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -29
score = 5.46119
sequence = TGCTGTATAAAAAAACAGGT

Site:
position = -49
score = 5.29087
sequence = CACTGTATATACTGCCAGTG

Gene: ASA_4206: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Tolumonas auensis DSM 9187

Site:
position = -27
score = 5.00638
sequence = ATCTGTATAAAAACACAGGC

Site:
position = -47
score = 5.6257
sequence = AACTGTATATACTCACAGTT

Gene: Tola_0146: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
 
CRON 3.
recN
*
Psychromonas ingrahamii 37

Site:
position = -48
score = 5.22
sequence = GACTGTGCAAATAAACAGTG

Site:
position = -71
score = 6.08937
sequence = TACTGTTTAAAAAAACAGTA

Gene: Ping_0914: DNA repair protein RecN
*
Psychromonas sp. CNPT3

Site:
position = -33
score = 5.59879
sequence = CACTGTTCATACAAACAGTA

Site:
position = -56
score = 6.08937
sequence = TACTGTTTAAAAAAACAGTA

Gene: PCNPT3_10460: DNA repair protein RecN
*
Moritella sp. PE36

Site:
position = -25
score = 4.17354
sequence = GGCTGATAAAATAAACAGGA

Site:
position = -42
score = 5.53767
sequence = TACTGTATATAAAACCAGGC

Gene: PE36_05748: DNA repair protein RecN
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -45
score = 5.76992
sequence = TACTGGATACATACACAGTA

Site:
position = -67
score = 5.5647
sequence = TACTGTATGGAAAACCAGTA

Gene: AHA_2986: DNA repair protein RecN
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -45
score = 5.53198
sequence = TACTGGATGCATACACAGTA

Site:
position = -67
score = 5.5647
sequence = TACTGTATGGAAAACCAGTA

Gene: ASA_2999: DNA repair protein RecN
*
Tolumonas auensis DSM 9187

Site:
position = -61
score = 5.91132
sequence = TACTGTATCTATATACAGTA

Site:
position = -101
score = 5.70962
sequence = AACTGTTTTAATATACAGTA

Gene: Tola_2260: DNA repair protein RecN
DNA repair protein RecN
 
CRON 4.
topB
*
Psychromonas ingrahamii 37

Site:
position = -34
score = 5.83704
sequence = TACTGTGTAAAAAAACAGTT

Gene: Ping_2461: DNA topoisomerase III (EC 5.99.1.2)
*
Psychromonas sp. CNPT3

Site:
position = -76
score = 6.04893
sequence = TACTGTCTATATAAACAGTT

Gene: PCNPT3_08640: DNA topoisomerase III (EC 5.99.1.2)
*
Moritella sp. PE36

Site:
position = -36
score = 5.53459
sequence = AACTGTTTATTCATACAGTC

Gene: PE36_16620: DNA topoisomerase III (EC 5.99.1.2)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -34
score = 5.77251
sequence = TACTGTTCACATATACAGTA

Gene: AHA_4047: DNA topoisomerase III (EC 5.99.1.2)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -36
score = 5.53457
sequence = TACTGTTCGCATATACAGTA

Gene: ASA_0267: DNA topoisomerase III (EC 5.99.1.2)
 
Tolumonas auensis DSM 9187

Gene: Tola_2404: DNA topoisomerase III (EC 5.99.1.2)
DNA topoisomerase III (EC 5.99.1.2)
 
CRON 5.
dinB
 
Psychromonas ingrahamii 37

Gene: Ping_1342: DNA polymerase IV (EC 2.7.7.7)
*
Psychromonas sp. CNPT3

Site:
position = -55
score = 5.96044
sequence = TACTGTATATATAATCAGTT

Gene: PCNPT3_05579: DNA polymerase IV (EC 2.7.7.7)
*
Moritella sp. PE36

Site:
position = -50
score = 4.83216
sequence = AACTGGTCTTTTATACAGTG

Gene: PE36_21990: DNA polymerase IV (EC 2.7.7.7)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -22
score = 4.92002
sequence = ACCTGTTTATTCGTACAGTG

Gene: AHA_1145: DNA polymerase IV (EC 2.7.7.7)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = 11
score = 5.22418
sequence = AACTGTTTATTCGTACAGTG

Gene: ASA_3190: DNA polymerase IV (EC 2.7.7.7)
*
Tolumonas auensis DSM 9187

Site:
position = -25
score = 5.48396
sequence = TACTGTGTATTTGTACAGTA

Gene: Tola_0804: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 6.
uvrA
 
Psychromonas ingrahamii 37

Gene: Ping_0369: Excinuclease ABC subunit A
*
Psychromonas sp. CNPT3

Site:
position = -37
score = 5.38456
sequence = TACTGTTTTAATTAACAGTG

Gene: PCNPT3_12972: Excinuclease ABC subunit A
 
Moritella sp. PE36

Gene: PE36_14400: Excinuclease ABC subunit A
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -72
score = 5.18796
sequence = ACCTGTCTATTCATCCAGTA

Gene: AHA_3955: Excinuclease ABC subunit A
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -72
score = 5.18796
sequence = ACCTGTCTATTCATCCAGTA

Gene: ASA_3999: Excinuclease ABC subunit A
*
Tolumonas auensis DSM 9187

Site:
position = -68
score = 5.21784
sequence = TACTGGCTATTCATCCAGTG

Gene: Tola_0231: Excinuclease ABC subunit A
Excinuclease ABC subunit A
 
CRON 7.
yebG
*
Psychromonas ingrahamii 37

Site:
position = -95
score = 5.45973
sequence = TACTGTATAAAAATACATGA

Gene: Ping_2220: SOS regulon DNA damage-inducible protein
*
Psychromonas sp. CNPT3

Site:
position = 74
score = 5.30566
sequence = TACTGTATATAAAACCATGA

Gene: PCNPT3_06468: SOS regulon DNA damage-inducible protein
*
Moritella sp. PE36

Site:
position = -38
score = 4.75959
sequence = CACTGTCATAATATACAGTG

Gene: PE36_11847: SOS regulon DNA damage-inducible protein
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -53
score = 4.67665
sequence = TACTGTATATCCATACATAT

Gene: AHA_2277: SOS regulon DNA damage-inducible protein
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
SOS regulon DNA damage-inducible protein
 
CRON 8.
recG
 
Psychromonas ingrahamii 37

Gene: Ping_3492: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_02260: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Moritella sp. PE36

Site:
position = -35
score = 5.37046
sequence = ATATGTTTATATATACAGTA

Gene: PE36_16064: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -35
score = 5.01718
sequence = ATCTGGACATATTTACAGTG

Gene: AHA_0284: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -35
score = 4.32831
sequence = ATTTGGACATATTTACAGTG

Gene: ASA_4113: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Tolumonas auensis DSM 9187

Site:
position = -32
score = 5.21423
sequence = ATCTGGATAAATTCACAGTA

Gene: Tola_0241: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
CRON 9.
uvrD
*
Psychromonas ingrahamii 37

Site:
position = -28
score = 5.5474
sequence = TACTGAATAAATAAACAGGT

Gene: Ping_0008: ATP-dependent DNA helicase II
*
Psychromonas sp. CNPT3

Site:
position = -28
score = 5.23069
sequence = TACTGATTAAATAGACAGGT

Gene: PCNPT3_01364: ATP-dependent DNA helicase II
*
Moritella sp. PE36

Site:
position = -35
score = 5.55399
sequence = TACTGATTAAATATACAGTC

Gene: PE36_15844: ATP-dependent DNA helicase II
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -26
score = 5.38669
sequence = GCCTGTATAAATAAACAGGA

Gene: AHA_0220: ATP-dependent DNA helicase II
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -26
score = 5.38669
sequence = GCCTGTATAAATAAACAGGA

Gene: ASA_4174: ATP-dependent DNA helicase II
*
Tolumonas auensis DSM 9187

Site:
position = -58
score = 4.59852
sequence = TACTGTATAAAAACCCACCC

Gene: Tola_0349: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 10.
polB
 
Psychromonas ingrahamii 37

Gene: Ping_1857: DNA polymerase II (EC 2.7.7.7)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08290: DNA polymerase II (EC 2.7.7.7)
*
Moritella sp. PE36

Site:
position = -45
score = 4.82065
sequence = TGCTGTACACTTAACCAGTC

Gene: PE36_19455: DNA polymerase II (EC 2.7.7.7)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -52
score = 4.79148
sequence = CACTGTATGAACGTACAATA

Gene: AHA_2107: DNA polymerase II (EC 2.7.7.7)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -73
score = 4.79148
sequence = CACTGTATGAACGTACAATA

Gene: ASA_2190: DNA polymerase II (EC 2.7.7.7)
 
Tolumonas auensis DSM 9187

Gene: Tola_2147: DNA polymerase II (EC 2.7.7.7)
DNA polymerase II (EC 2.7.7.7)
 
CRON 11.
recX
 
Psychromonas ingrahamii 37

Gene: Ping_2629: Regulatory protein RecX
*
Psychromonas sp. CNPT3

Site:
position = -43
score = 5.57814
sequence = TACTGTTCATAATAACAGTA

Gene: PCNPT3_07113: Regulatory protein RecX
 
Moritella sp. PE36

Gene: PE36_08961: Regulatory protein RecX
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3715: Regulatory protein RecX
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3810: Regulatory protein RecX
 
Tolumonas auensis DSM 9187

Gene: Tola_2730: Regulatory protein RecX
Regulatory protein RecX
radA
 
Psychromonas ingrahamii 37

Gene: Ping_2630: DNA repair protein RadA
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07108: DNA repair protein RadA
*
Moritella sp. PE36

Site:
position = -65
score = 5.4325
sequence = AACTGTATATACATCCAGAT

Gene: PE36_11322: DNA repair protein RadA
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3681: DNA repair protein RadA
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3647: DNA repair protein RadA
 
Tolumonas auensis DSM 9187

Gene: Tola_2595: DNA repair protein RadA
DNA repair protein RadA
recA
*
Psychromonas ingrahamii 37

Site:
position = -55
score = 5.16122
sequence = TACTGAGTGCATATACAGTT

Site:
position = -89
score = 5.50722
sequence = TACTGTGTAAATCAACAGTA

Gene: Ping_3381: Recombinase A
*
Psychromonas sp. CNPT3

Site:
position = -65
score = 5.57621
sequence = TACTGTATGAATAGTCAGTA

Site:
position = -45
score = 5.41566
sequence = AACTGATCATATAAACAGTA

Gene: PCNPT3_13378: Recombinase A
*
Moritella sp. PE36

Site:
position = -68
score = 5.53995
sequence = TACTGTATGAACGAACAGTA

Gene: PE36_23016: Recombinase A
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -68
score = 5.94892
sequence = TACTGTATGAATAGACAGTA

Gene: AHA_3716: Recombinase A
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -69
score = 5.94892
sequence = TACTGTATGAATAGACAGTA

Gene: ASA_3809: Recombinase A
*
Tolumonas auensis DSM 9187

Site:
position = -64
score = 5.86857
sequence = TACTGTATGGATAAACAGTA

Gene: Tola_2731: Recombinase A
Recombinase A
 
CRON 12.
SSF52540
*
Psychromonas ingrahamii 37

Site:
position = -26
score = 4.4664
sequence = CAGTGTTTTTAAATACAGGT

Site:
position = -41
score = 4.83322
sequence = TACTGTTGTTTTATACAGTG

Gene: Ping_2235: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
*
Psychromonas sp. CNPT3

Site:
position = -43
score = 5.1382
sequence = TACTGTTAACTTATACAGTG

Site:
position = -28
score = 4.02912
sequence = CAGTGGTTTTATTTACAGGG

Gene: PCNPT3_06983: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
*
Moritella sp. PE36

Site:
position = -22
score = 4.68812
sequence = CACTGGATATGCAAACAGGC

Site:
position = -37
score = 5.39567
sequence = TACTGTATGTATAACCACTG

Gene: PE36_14089: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD