Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 111 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 13 11
Alteromonas macleodii 'Deep ecotype' 10 10
Glaciecola sp. HTCC2999 11 9
Colwellia psychrerythraea 34H 15 12
Alteromonadales bacterium TW-7 12 11
Pseudoalteromonas haloplanktis TAC125 15 12
Pseudoalteromonas tunicata D2 14 11
Idiomarina baltica OS145 7 5
Idiomarina loihiensis L2TR 8 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ruvC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2946: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = 7
score = 4.71063
sequence = TACTGGGTATAGATCCAGGT

Gene: MADE_01729: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100005784: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
*
Colwellia psychrerythraea 34H

Site:
position = -115
score = 4.33899
sequence = TACTGTATATCAGTAATGTT

Gene: CPS_2115: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Alteromonadales bacterium TW-7

Gene: ATW7_08572: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -69
score = 5.29907
sequence = TACTGGTAATTTATACAGTG

Gene: PSHAa1877: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
*
Pseudoalteromonas tunicata D2

Site:
position = -66
score = 5.17278
sequence = CACTGGTAATTTATACAGTT

Gene: PTD2_22617: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Idiomarina baltica OS145

Gene: OS145_11312: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
 
Idiomarina loihiensis L2TR

Gene: IL1087: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
ruvA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2945: Holliday junction DNA helicase RuvA
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02691: Holliday junction DNA helicase RuvA
*
Glaciecola sp. HTCC2999

Site:
position = -69
score = 5.26631
sequence = ACTTGTATATATGTACAGTA

Site:
position = -56
score = 4.57203
sequence = TACAGTATTTTAGTACACTA

Gene: GHTCC_010100005779: Holliday junction DNA helicase RuvA
*
Colwellia psychrerythraea 34H

Site:
position = -60
score = 5.67545
sequence = TACTGTATAAATATATAGTG

Gene: CPS_2116: Holliday junction DNA helicase RuvA
 
Alteromonadales bacterium TW-7

Gene: ATW7_08567: Holliday junction DNA helicase RuvA
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1876: Holliday junction DNA helicase RuvA
 
Pseudoalteromonas tunicata D2

Gene: PTD2_22612: Holliday junction DNA helicase RuvA
 
Idiomarina baltica OS145

Gene: OS145_11317: Holliday junction DNA helicase RuvA
 
Idiomarina loihiensis L2TR

Gene: IL1086: Holliday junction DNA helicase RuvA
Holliday junction DNA helicase RuvA
ruvB
*
Pseudoalteromonas atlantica T6c

Site:
position = -40
score = 5.43435
sequence = CACTGTATATAAAACCACTA

Gene: Patl_2944: Holliday junction DNA helicase RuvB
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02690: Holliday junction DNA helicase RuvB
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100005774: Holliday junction DNA helicase RuvB
 
Colwellia psychrerythraea 34H

Gene: CPS_2117: Holliday junction DNA helicase RuvB
 
Alteromonadales bacterium TW-7

Gene: ATW7_08562: Holliday junction DNA helicase RuvB
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1875: Holliday junction DNA helicase RuvB
 
Pseudoalteromonas tunicata D2

Gene: PTD2_22607: Holliday junction DNA helicase RuvB
 
Idiomarina baltica OS145

Gene: OS145_11322: Holliday junction DNA helicase RuvB
 
Idiomarina loihiensis L2TR

Gene: IL1085: Holliday junction DNA helicase RuvB
Holliday junction DNA helicase RuvB
 
CRON 2.
dinB
*
Pseudoalteromonas atlantica T6c

Site:
position = -29
score = 5.75735
sequence = AACTGTTTTTAAATACAGTT

Gene: Patl_0460: DNA polymerase IV (EC 2.7.7.7)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -76
score = 5.28467
sequence = TACTGTCTTTTTGTACAGTT

Gene: MADE_00753: DNA polymerase IV (EC 2.7.7.7)
*
Glaciecola sp. HTCC2999

Site:
position = -34
score = 5.68134
sequence = TACTGGATTAATAAACAGTG

Gene: GHTCC_010100007177: DNA polymerase IV (EC 2.7.7.7)
*
Colwellia psychrerythraea 34H

Site:
position = -38
score = 6.02703
sequence = TACTGTTTTTATATACAGTT

Gene: CPS_1040: DNA polymerase IV (EC 2.7.7.7)
*2
Alteromonadales bacterium TW-7

Gene: ATW7_11110: DNA polymerase IV (EC 2.7.7.7)

Site:
position = -41
score = 5.1985
sequence = CACTGTATTTTTATACAGCC

Gene: ATW7_11140: DNA polymerase IV (EC 2.7.7.7)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -32
score = 5.65149
sequence = GGCTGTATAAATAAACAGTT

Gene: PSHAa2389: DNA polymerase IV (EC 2.7.7.7)
*
Pseudoalteromonas tunicata D2

Site:
position = -52
score = 6.12203
sequence = TACTGTATAAAAAAACAGTG

Gene: PTD2_12644: DNA polymerase IV (EC 2.7.7.7)
 
Idiomarina baltica OS145

Gene: OS145_02620: DNA polymerase IV (EC 2.7.7.7)
 
Idiomarina loihiensis L2TR

Gene: IL0204: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 3.
yebG
*
Pseudoalteromonas atlantica T6c

Site:
position = -63
score = 5.62403
sequence = AACTGTACATAAAAACAGGT

Gene: Patl_1244: SOS regulon DNA damage-inducible protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -65
score = 6.07086
sequence = TACTGTTTATTTATACAGTT

Gene: MADE_03780: SOS regulon DNA damage-inducible protein
*
Glaciecola sp. HTCC2999

Site:
position = -73
score = 5.64326
sequence = TACTGTTAATTTATACAGTG

Site:
position = -120
score = 6.21831
sequence = AACTGTATTTATATACAGTA

Gene: GHTCC_010100001654: SOS regulon DNA damage-inducible protein
*
Colwellia psychrerythraea 34H

Site:
position = -127
score = 5.41491
sequence = AACTGTTTTTATATACAGCT

Gene: CPS_4298: SOS regulon DNA damage-inducible protein
*
Alteromonadales bacterium TW-7

Site:
position = -71
score = 6.42358
sequence = TACTGTATATAAAAACAGTA

Gene: ATW7_09848: SOS regulon DNA damage-inducible protein
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -70
score = 6.12777
sequence = TACTGTACATAAAAACAGTA

Gene: PSHAa0834: SOS regulon DNA damage-inducible protein
*
Pseudoalteromonas tunicata D2

Site:
position = -85
score = 6.25039
sequence = TACTGTATATAAAAACAGTG

Gene: PTD2_15577: SOS regulon DNA damage-inducible protein
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -48
score = 6.13966
sequence = TACTGTACAAATAAACAGTA

Gene: IL1548: SOS regulon DNA damage-inducible protein
SOS regulon DNA damage-inducible protein
 
CRON 4.
lexA
*
Pseudoalteromonas atlantica T6c

Site:
position = -25
score = 4.94887
sequence = AACTGTATGAAACAACAGGC

Site:
position = -46
score = 5.53076
sequence = GACTGTATATACTCACAGTT

Gene: Patl_4247: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -44
score = 4.7777
sequence = AGGTGTATATACTTACAGGA

Site:
position = -25
score = 5.04261
sequence = AACTGTATGAACAGACAGGT

Gene: MADE_04014: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Glaciecola sp. HTCC2999

Site:
position = -25
score = 5.33883
sequence = AACTGTATTAATTAACAGGC

Site:
position = -44
score = 5.82001
sequence = TACTGGATATACTAACAGTA

Gene: GHTCC_010100008871: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Colwellia psychrerythraea 34H

Site:
position = -27
score = 5.34003
sequence = TACTGTGTAAATTTACAGGC

Site:
position = -48
score = 5.45807
sequence = TCCTGTATATACTACCAGTA

Gene: CPS_0237: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Alteromonadales bacterium TW-7

Site:
position = -47
score = 5.71644
sequence = AACTGTATATACTCACAGTT

Site:
position = -22
score = 5.47753
sequence = TACTGTATGGAAAACCAGTT

Gene: ATW7_16997: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -91
score = 5.47753
sequence = TACTGTATGGAAAACCAGTT

Site:
position = -116
score = 5.71644
sequence = AACTGTATATACTCACAGTT

Gene: PSHAa2873: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Pseudoalteromonas tunicata D2

Site:
position = -45
score = 5.48981
sequence = AGCTGTATATAATCACAGTA

Gene: PTD2_16946: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Idiomarina baltica OS145

Site:
position = -47
score = 5.392
sequence = ACCTGTATATACTCACAGTA

Site:
position = -27
score = 5.58593
sequence = TACTGTACAGATAAACAGGT

Gene: OS145_02170: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Idiomarina loihiensis L2TR

Site:
position = -46
score = 5.392
sequence = ACCTGTATATACTCACAGTA

Site:
position = -25
score = 5.5483
sequence = CACTGTACAAATAAACAGGT

Gene: IL0262: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
 
CRON 5.
Patl_2012
*
Pseudoalteromonas atlantica T6c

Site:
position = -28
score = 5.4523
sequence = CACTGTATAAACAAACAGGC

Site:
position = -64
score = 4.88806
sequence = GCATGTATTTTTATACAGTA

Gene: Patl_2012: hypothetical protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -64
score = 4.93407
sequence = CACTGTATAAGAAGCCAGTA

Site:
position = -81
score = 4.78787
sequence = TACTGTATACACATACACAC

Gene: MADE_01066: hypothetical protein
*
Glaciecola sp. HTCC2999

Site:
position = -28
score = 5.15228
sequence = CACTGTATAAATAAACAAGG

Site:
position = -61
score = 5.83817
sequence = GACTGTTTATTTATACAGTA

Gene: GHTCC_010100006337: hypothetical protein
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
 
CRON 6.
dnaQ
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2348: DNA polymerase III epsilon subunit (EC 2.7.7.7)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -48
score = 5.28168
sequence = GGCTGTATAAATATACACTA

Gene: MADE_03930: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = 8
score = 6.02703
sequence = TACTGTTTTTATATACAGTT

Gene: ATW7_09096: DNA polymerase III epsilon subunit (EC 2.7.7.7)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = 8
score = 5.37017
sequence = TACTGTTTTTATATACAGCC

Gene: PSHAa1996: DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
DNA polymerase III epsilon subunit (EC 2.7.7.7)
 
CRON 7.
ATW7_03087
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -49
score = 5.9019
sequence = TACTGTACATTTAAACAGTG

Gene: ATW7_03087: Putative orphan protein
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -49
score = 6.2612
sequence = AACTGTATATATAAACAGTG

Gene: PSHAb0389: Putative orphan protein
*
Pseudoalteromonas tunicata D2

Site:
position = -38
score = 6.03334
sequence = CACTGTATATAAAAACAGTG

Gene: PTD2_02786: Putative orphan protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Putative orphan protein
 
CRON 8.
imuA
*
Pseudoalteromonas atlantica T6c

Site:
position = -31
score = 4.0873
sequence = TACAGTAAAAATATACAACC

Site:
position = -44
score = 6.19957
sequence = TACTGTATGAATATACAGTA

Gene: Patl_0036: Predicted RecA/RadA recombinase
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -33
score = 6.23348
sequence = TACTGTATAAAAATACAGTT

Gene: MADE_00040: Predicted RecA/RadA recombinase
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -36
score = 6.28869
sequence = TACTGTACATATATACAGTA

Gene: OS145_09460: Predicted RecA/RadA recombinase
*
Idiomarina loihiensis L2TR

Site:
position = -32
score = 6.30653
sequence = TACTGTATATATGTACAGTA

Gene: IL2568: Predicted RecA/RadA recombinase
Predicted RecA/RadA recombinase
imuB
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0035: DNA polymerase-like protein PA0670
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00039: DNA polymerase-like protein PA0670
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_09455: DNA polymerase-like protein PA0670
 
Idiomarina loihiensis L2TR

Gene: IL2567: DNA polymerase-like protein PA0670
DNA polymerase-like protein PA0670
dnaE2
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_00038: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_09450: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Idiomarina loihiensis L2TR

Gene: IL2566: DNA polymerase III alpha subunit (EC 2.7.7.7)
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 9.
topB
*
Pseudoalteromonas atlantica T6c

Site:
position = -43
score = 5.36375
sequence = TACTGTCTTTACATACAGTC

Gene: Patl_0776: DNA topoisomerase III (EC 5.99.1.2)
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -71
score = 5.31261
sequence = AGCTGTACATAAAACCAGTA

Gene: CPS_4792: DNA topoisomerase III (EC 5.99.1.2)
*
Alteromonadales bacterium TW-7

Site:
position = -32
score = 5.94383
sequence = TACTGTTTATATAACCAGTT

Gene: ATW7_10960: DNA topoisomerase III (EC 5.99.1.2)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -94
score = 4.07626
sequence = AACTAGAGATATATAAAGTT

Gene: PSHAa2356: DNA topoisomerase III (EC 5.99.1.2)
*
Pseudoalteromonas tunicata D2

Site:
position = -33
score = 5.20643
sequence = CACTGTTAATCTATACAGTT

Gene: PTD2_09304: DNA topoisomerase III (EC 5.99.1.2)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
DNA topoisomerase III (EC 5.99.1.2)
 
CRON 10.
umuD
*
Pseudoalteromonas atlantica T6c

Site:
position = -21
score = 6.06842
sequence = TACTGTATATAATAACAGTG

Gene: Patl_2345: DNA polymerase V, subunit UmuD
 
Alteromonas macleodii 'Deep ecotype'
*
Glaciecola sp. HTCC2999

Site:
position = -54
score = 6.36183
sequence = TACTGTATATAAATACAGTT

Site:
position = -101
score = 6.03645
sequence = CACTGTATAAATTAACAGTA

Gene: GHTCC_010100001659: DNA polymerase V, subunit UmuD
*2
Colwellia psychrerythraea 34H

Site:
position = -35
score = 6.26228
sequence = TACTGTATATAATTACAGTA

Gene: CPS_2683: DNA polymerase V, subunit UmuD

Site:
position = -35
score = 6.06978
sequence = TACTGTATTTATGTACAGTA

Gene: CPS_1635: DNA polymerase V, subunit UmuD
*
Alteromonadales bacterium TW-7

Site:
position = -21
score = 5.76984
sequence = TACTGTACACTTATACAGTA

Gene: ATW7_00530: DNA polymerase V, subunit UmuD
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -41
score = 5.78768
sequence = TACTGTATACTTGTACAGTA

Gene: PSHAb0537: DNA polymerase V, subunit UmuD
*
Pseudoalteromonas tunicata D2

Site:
position = -21
score = 6.03238
sequence = TACTGTATATAACTACAGTA

Gene: PTD2_17880: DNA polymerase V, subunit UmuD
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
DNA polymerase V, subunit UmuD
umuC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2344: DNA polymerase V, subunit UmuC
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100001664: DNA polymerase V, subunit UmuC
 2
Colwellia psychrerythraea 34H

Gene: CPS_2682: DNA polymerase V, subunit UmuC

Gene: CPS_1636: DNA polymerase V, subunit UmuC
 
Alteromonadales bacterium TW-7

Gene: ATW7_00525: DNA polymerase V, subunit UmuC
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0536: DNA polymerase V, subunit UmuC
 
Pseudoalteromonas tunicata D2

Gene: PTD2_17875: DNA polymerase V, subunit UmuC
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
DNA polymerase V, subunit UmuC
 
CRON 11.
SSF52540
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -55
score = 5.83919
sequence = TACTGTACGTTTATACAGTA

Gene: CPS_3201: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
*
Alteromonadales bacterium TW-7

Site:
position = -31
score = 5.7152
sequence = TACTGTATATAAACCCAGTG

Site:
position = -44
score = 5.4293
sequence = TACTGTATACATGTACTGTA

Gene: ATW7_06613: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -32
score = 5.58684
sequence = TACTGTATAAAAACCCAGTG

Site:
position = -45
score = 4.85487
sequence = TACTGTATATGGGTACTGTA

Gene: PSHAa1159: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
*
Pseudoalteromonas tunicata D2

Site:
position = -28
score = 5.70149
sequence = CACTGTATAAACAACCAGTA

Gene: PTD2_18455: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
 
CRON 12.
recA
*
Pseudoalteromonas atlantica T6c

Site:
position = -106
score = 5.41982
sequence = AACTGTATGGTTGTACAGTA

Gene: Patl_3259: Recombinase A
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -107
score = 5.40167
sequence = AACTGTATGCTTGTACAGTA

Gene: MADE_03079: Recombinase A
*
Glaciecola sp. HTCC2999

Site:
position = -75
score = 6.04617
sequence = CACTGTATAATTATACAGTA

Gene: GHTCC_010100000340: Recombinase A
*
Colwellia psychrerythraea 34H

Site:
position = -68
score = 5.50414
sequence = TACTGTACGAACTTACAGTA

Gene: CPS_4134: Recombinase A
*
Alteromonadales bacterium TW-7

Site:
position = -54
score = 4.98107
sequence = TACTGTGGTTTCATACAGTA

Gene: ATW7_04497: Recombinase A
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -53
score = 5.21467
sequence = TACTGTGATTTCATACAGTA

Gene: PSHAa0694: Recombinase A
*
Pseudoalteromonas tunicata D2

Site:
position = -55
score = 5.5059
sequence = TACTGTTAATCTATACAGTA

Gene: PTD2_13014: Recombinase A
*
Idiomarina baltica OS145

Site:
position = -57
score = 5.66907
sequence = TACTGTGAATTTATACAGTA

Gene: OS145_07237: Recombinase A
*
Idiomarina loihiensis L2TR

Site:
position = -59
score = 5.53977
sequence = TACTGTAAATGTGTACAGTA

Site:
position = -39
score = 5.71282
sequence = TACTGTTTATAAAACCAGTG

Gene: IL0742: Recombinase A
Recombinase A
 
CRON 13.
uvrD
*
Pseudoalteromonas atlantica T6c

Site:
position = -64
score = 5.42594
sequence = AATTGTATAAAAACACAGTA

Gene: Patl_4079: ATP-dependent DNA helicase II
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -79
score = 5.38991
sequence = GACTGTATAAATTAACAGGC

Gene: MADE_00200: ATP-dependent DNA helicase II
*
Glaciecola sp. HTCC2999

Site:
position = -70
score = 5.85249
sequence = CACTGTATATATCAACAGTT

Gene: GHTCC_010100004134: ATP-dependent DNA helicase II
*
Colwellia psychrerythraea 34H

Site:
position = -130
score = 5.86188
sequence = TACTGTAATAATAAACAGTA

Gene: CPS_0080: ATP-dependent DNA helicase II
*
Alteromonadales bacterium TW-7

Site:
position = -84
score = 5.37359
sequence = AGCTGTTCATAAAAACAGTA

Gene: ATW7_15466: ATP-dependent DNA helicase II
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -84
score = 5.52203
sequence = AGCTGTGTATAAAAACAGTA

Gene: PSHAa0122: ATP-dependent DNA helicase II
*
Pseudoalteromonas tunicata D2

Site:
position = -84
score = 5.35318
sequence = ACCTGTTCATAAAAACAGTA

Gene: PTD2_09564: ATP-dependent DNA helicase II
*
Idiomarina baltica OS145

Site:
position = -66
score = 5.09716
sequence = AACTGGTTGCTTATACAGTA

Gene: OS145_09368: ATP-dependent DNA helicase II
*
Idiomarina loihiensis L2TR

Site:
position = -83
score = 5.0534
sequence = TACTGGTTGCTTATACAGTG

Gene: IL2551: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 14.
recN
*
Pseudoalteromonas atlantica T6c

Site:
position = -26
score = 5.71862
sequence = TACTGTATATTTGAACAGGT

Site:
position = -45
score = 5.06031
sequence = ATATGTATATATTTACAGTT

Gene: Patl_1714: DNA repair protein RecN
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -41
score = 4.50844
sequence = TACTGTATATATCATCATGT

Site:
position = -60
score = 5.71387
sequence = TACTGTATATATTATCAGTT

Gene: MADE_02270: DNA repair protein RecN
*
Glaciecola sp. HTCC2999

Site:
position = -28
score = 5.45787
sequence = TATTGTATATTTACACAGTG

Site:
position = -47
score = 5.32364
sequence = TACTGTATATATTTACACAT

Gene: GHTCC_010100008506: DNA repair protein RecN
*
Colwellia psychrerythraea 34H

Site:
position = -58
score = 6.17108
sequence = TACTGTATAAATTAACAGTT

Gene: CPS_3825: DNA repair protein RecN
*
Alteromonadales bacterium TW-7

Site:
position = -43
score = 5.65475
sequence = CACTGTATAAATTACCAGTT

Site:
position = -19
score = 5.52585
sequence = AACTGGATGGATAAACAGTA

Gene: ATW7_06923: DNA repair protein RecN
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -43
score = 5.95403
sequence = CACTGTATAAATTAACAGTT

Site:
position = -19
score = 5.34017
sequence = GACTGGATGGATAAACAGTA

Gene: PSHAa1218: DNA repair protein RecN
*
Pseudoalteromonas tunicata D2

Site:
position = -43
score = 6.17108
sequence = TACTGTATAAATTAACAGTT

Site:
position = -19
score = 5.52585
sequence = AACTGGATGGATAAACAGTA

Gene: PTD2_10739: DNA repair protein RecN
*
Idiomarina baltica OS145

Site:
position = -52
score = 5.82612
sequence = TACTGTATAGGTAAACAGTA

Gene: OS145_12305: DNA repair protein RecN
*
Idiomarina loihiensis L2TR

Site:
position = -34
score = 5.61566
sequence = ACCTGTATATATCAACAGTA

Gene: IL0989: DNA repair protein RecN
DNA repair protein RecN
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD