Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 96 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20 11 9
Aggregatibacter aphrophilus NJ8700 11 9
Pasteurella multocida subsp. multocida str. Pm70 11 9
Mannheimia succiniciproducens MBEL55E 10 8
Actinobacillus succinogenes 130Z 10 8
Haemophilus somnus 2336 10 8
Actinobacillus pleuropneumoniae serovar 7 str. AP76 9 7
Haemophilus ducreyi 35000HP 11 8
Haemophilus parasuis SH0165 8 7
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ruvA
*
Haemophilus influenzae Rd KW20

Site:
position = -64
score = 4.67357
sequence = AACTGGATGTTCGTCCAGTT

Gene: HI0313: Holliday junction DNA helicase RuvA
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -66
score = 5.6256
sequence = AACTGGATATTTATCCAGTT

Gene: NT05HA_1353: Holliday junction DNA helicase RuvA
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -65
score = 5.01169
sequence = AACTGGATGTTCATCCAGTT

Gene: PM0977: Holliday junction DNA helicase RuvA
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -65
score = 5.04246
sequence = AACTGGTTATCTATCCAGTT

Gene: MS0712: Holliday junction DNA helicase RuvA
*
Actinobacillus succinogenes 130Z

Site:
position = -60
score = 4.07158
sequence = AGCTGTTGTTTTATTCAGTT

Gene: Asuc_1800: Holliday junction DNA helicase RuvA
*
Haemophilus somnus 2336

Site:
position = -65
score = 5.6256
sequence = AACTGGATATTTATCCAGTT

Gene: HSM_0142: Holliday junction DNA helicase RuvA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0285: Holliday junction DNA helicase RuvA
*
Haemophilus ducreyi 35000HP

Site:
position = -106
score = 4.97069
sequence = GCCTGTTTTTTTATACAGTT

Gene: HD1758: Holliday junction DNA helicase RuvA
 
Haemophilus parasuis SH0165

Gene: HAPS_1346: Holliday junction DNA helicase RuvA
Holliday junction DNA helicase RuvA
ruvB
 
Haemophilus influenzae Rd KW20

Gene: HI0312: Holliday junction DNA helicase RuvB
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1352: Holliday junction DNA helicase RuvB
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0976: Holliday junction DNA helicase RuvB
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0713: Holliday junction DNA helicase RuvB
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1799: Holliday junction DNA helicase RuvB
 
Haemophilus somnus 2336

Gene: HSM_0143: Holliday junction DNA helicase RuvB
 2
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0286: Holliday junction DNA helicase RuvB

Gene: APP7_0287: Holliday junction DNA helicase RuvB
 
Haemophilus ducreyi 35000HP

Gene: HD1757: Holliday junction DNA helicase RuvB
 
Haemophilus parasuis SH0165

Gene: HAPS_0995: Holliday junction DNA helicase RuvB
Holliday junction DNA helicase RuvB
 
CRON 2.
lexA
*
Haemophilus influenzae Rd KW20

Site:
position = -46
score = 5.20869
sequence = ATCTGTATACAATACCAGTT

Site:
position = -26
score = 5.03613
sequence = ATCTGTGTTTAAAAACAGGA

Gene: HI0749: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -28
score = 4.87744
sequence = TCATGTATATATTAACAGGA

Site:
position = -50
score = 5.24265
sequence = TTCTGTATATAATACCAGTC

Gene: NT05HA_1581: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -47
score = 5.82771
sequence = TTCTGTATATAATAACAGTT

Site:
position = -26
score = 5.34762
sequence = TTCTGTATAAAAAAACAGGG

Gene: PM1181: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -11
score = 4.5925
sequence = TCCTGTATATAATGTCAGCA

Site:
position = 9
score = 5.09601
sequence = TTCTGTACAAAAAAACAGGG

Gene: MS0744: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Actinobacillus succinogenes 130Z

Site:
position = -46
score = 4.43648
sequence = AACTGTATAGAATATCAATC

Gene: Asuc_0877: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Haemophilus somnus 2336

Site:
position = -26
score = 5.42829
sequence = TTCTGTATATAAAAACAGGG

Site:
position = -47
score = 4.88961
sequence = TTCTGTATATAATATCATAT

Gene: HSM_0711: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -49
score = 5.31446
sequence = TACTGTATATAATAACAAAA

Site:
position = -28
score = 4.95833
sequence = ATCTGTATATAAAGACAGCG

Gene: APP7_1165: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Haemophilus ducreyi 35000HP

Site:
position = -28
score = 5.45583
sequence = TTCTGTATATAAAGACAGTG

Site:
position = -50
score = 5.31446
sequence = TACTGTATATAATAACACAA

Gene: HD0545: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Haemophilus parasuis SH0165

Site:
position = -28
score = 5.45583
sequence = TTCTGTATATAAAGACAGTG

Site:
position = -50
score = 4.70142
sequence = TACTGTATATAATGTCATAA

Gene: HAPS_0014: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
mutH
 
Haemophilus influenzae Rd KW20

Gene: HI0403: DNA mismatch repair endonuclease MutH
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0157: DNA mismatch repair endonuclease MutH
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1067: DNA mismatch repair endonuclease MutH
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0635: DNA mismatch repair endonuclease MutH
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1903: DNA mismatch repair endonuclease MutH
 
Haemophilus somnus 2336

Gene: HSM_0474: DNA mismatch repair endonuclease MutH
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1166: DNA mismatch repair endonuclease MutH
 
Haemophilus ducreyi 35000HP

Gene: HD0544: DNA mismatch repair endonuclease MutH
 
Haemophilus parasuis SH0165

Gene: HAPS_1358: DNA mismatch repair endonuclease MutH
DNA mismatch repair endonuclease MutH
 
CRON 3.
recA
*
Haemophilus influenzae Rd KW20

Site:
position = -60
score = 5.12711
sequence = ACCTGTACATCAATACAGAT

Gene: HI0600: Recombinase A
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -67
score = 6.07336
sequence = TACTGTATATTAATACAGTT

Gene: NT05HA_1941: Recombinase A
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -66
score = 5.55974
sequence = TACTGTTTATTCATACAGTT

Gene: PM1817: Recombinase A
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -69
score = 5.76786
sequence = TACTGTATATTATACCAGTT

Gene: MS2243: Recombinase A
*
Actinobacillus succinogenes 130Z

Site:
position = -63
score = 5.18491
sequence = TACTGTGTTTTATACCAGTT

Gene: Asuc_0261: Recombinase A
*
Haemophilus somnus 2336

Site:
position = -66
score = 5.20804
sequence = CACTGTATGTGAATACAGTA

Gene: HSM_0315: Recombinase A
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -86
score = 5.30369
sequence = AACTGTATAAGTAAACACTA

Gene: APP7_1202: Recombinase A
*
Haemophilus ducreyi 35000HP

Site:
position = -84
score = 5.30369
sequence = AACTGTATAAGTAAACACTA

Gene: HD0410: Recombinase A
*
Haemophilus parasuis SH0165

Site:
position = -84
score = 5.26607
sequence = AACTGTATGGTTAAACAGTA

Gene: HAPS_1186: Recombinase A
Recombinase A
recX
 
Haemophilus influenzae Rd KW20

Gene: HI0599: Regulatory protein RecX
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1940: Regulatory protein RecX
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1816: Regulatory protein RecX
 
Mannheimia succiniciproducens MBEL55E

Gene: MS2242: Regulatory protein RecX
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0260: Regulatory protein RecX
 
Haemophilus somnus 2336

Gene: HSM_0314: Regulatory protein RecX
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1201: Regulatory protein RecX
 
Haemophilus ducreyi 35000HP

Gene: HD0411: Regulatory protein RecX
 
Haemophilus parasuis SH0165

Gene: HAPS_1185: Regulatory protein RecX
Regulatory protein RecX
 
CRON 4.
recN
*
Haemophilus influenzae Rd KW20

Site:
position = -55
score = 5.06791
sequence = TACTGTAAATTAAGTCAGTT

Gene: HI0070: DNA repair protein RecN
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -55
score = 6.10257
sequence = TACTGTATATTAAAACAGTA

Gene: NT05HA_1273: DNA repair protein RecN
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -56
score = 6.23186
sequence = TACTGTATATAAAAACAGTT

Gene: PM0332: DNA repair protein RecN
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -54
score = 5.45437
sequence = TACTGTATAAAAAAACATAA

Gene: MS0741: DNA repair protein RecN
*
Actinobacillus succinogenes 130Z

Site:
position = -34
score = 4.21735
sequence = TATAATATATTTATACAGTA

Gene: Asuc_0884: DNA repair protein RecN
*
Haemophilus somnus 2336

Site:
position = -57
score = 5.59769
sequence = TACTGTATATAAAAACATAT

Site:
position = -33
score = 5.22101
sequence = AATTGTATTTATATACAGTA

Gene: HSM_0991: DNA repair protein RecN
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -61
score = 5.57638
sequence = TACTGTTCAAAAAAACAGTA

Gene: APP7_0025: DNA repair protein RecN
*
Haemophilus ducreyi 35000HP

Site:
position = -42
score = 4.95411
sequence = TACTATATATCTATACAGAA

Site:
position = -63
score = 5.82799
sequence = TACTGTTTAAAAAAACAGTA

Gene: HD0815: DNA repair protein RecN
*
Haemophilus parasuis SH0165

Site:
position = -61
score = 5.74269
sequence = TACTGTGTATAAAAACAGTG

Site:
position = -40
score = 4.63347
sequence = TACTATATACTCATACAGTG

Gene: HAPS_1355: DNA repair protein RecN
DNA repair protein RecN
 
CRON 5.
mfd
*
Haemophilus influenzae Rd KW20

Site:
position = -96
score = 5.63072
sequence = AACTGTTTTTTTAAACAGTT

Gene: HI1258: Transcription-repair coupling factor (superfamily II helicase)
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -86
score = 4.77276
sequence = CACTGTTTTTTTATACAGAC

Gene: NT05HA_0196: Transcription-repair coupling factor (superfamily II helicase)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -101
score = 4.37518
sequence = TACTGGCTTTTTATACAGAC

Gene: PM1041: Transcription-repair coupling factor (superfamily II helicase)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0216: Transcription-repair coupling factor (superfamily II helicase)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0557: Transcription-repair coupling factor (superfamily II helicase)
 
Haemophilus somnus 2336

Gene: HSM_1578: Transcription-repair coupling factor (superfamily II helicase)
 2
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1391: Transcription-repair coupling factor (superfamily II helicase)

Gene: APP7_1390: Transcription-repair coupling factor (superfamily II helicase)
 
Haemophilus ducreyi 35000HP

Gene: HD0975: Transcription-repair coupling factor (superfamily II helicase)
 
Haemophilus parasuis SH0165

Gene: HAPS_2079: Transcription-repair coupling factor (superfamily II helicase)
Transcription-repair coupling factor (superfamily II helicase)
 
CRON 6.
uvrD
*
Haemophilus influenzae Rd KW20

Site:
position = -32
score = 5.54567
sequence = AACTGTAAATTTAAACAGAT

Gene: HI1188: ATP-dependent DNA helicase II
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -36
score = 5.30758
sequence = GCCTGTACAAAAAAACAGTA

Gene: NT05HA_1086: ATP-dependent DNA helicase II
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -142
score = 6.15118
sequence = TACTGTATAAAAAAACAGTT

Gene: PM0411: ATP-dependent DNA helicase II
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -31
score = 5.1368
sequence = CCCTGTAAAAATAAACAGAT

Gene: MS1368: ATP-dependent DNA helicase II
*
Actinobacillus succinogenes 130Z

Site:
position = -30
score = 4.83202
sequence = TAGTGTAAATTTAAACAGAT

Gene: Asuc_1268: ATP-dependent DNA helicase II
*
Haemophilus somnus 2336

Site:
position = -31
score = 5.99839
sequence = AACTGTATAAAAACACAGTT

Gene: HSM_1774: ATP-dependent DNA helicase II
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -38
score = 5.10612
sequence = AACTGTATAAACGAACATTA

Gene: APP7_1377: ATP-dependent DNA helicase II
*
Haemophilus ducreyi 35000HP

Site:
position = -39
score = 4.82316
sequence = CACTGTATAAATGCACATTG

Gene: HD1032: ATP-dependent DNA helicase II
*
Haemophilus parasuis SH0165

Site:
position = -30
score = 4.9273
sequence = CACTGTATAAAATCACATAA

Gene: HAPS_1067: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 7.
uvrA
*
Haemophilus influenzae Rd KW20

Site:
position = -80
score = 5.19475
sequence = AACTGGATATTTGCACAGAT

Gene: HI0249: Excinuclease ABC subunit A
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -79
score = 5.39886
sequence = AACTGGATATTTGCACAGTT

Gene: NT05HA_2208: Excinuclease ABC subunit A
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -79
score = 5.39886
sequence = AACTGGATATTTGCACAGTT

Gene: PM1951: Excinuclease ABC subunit A
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -79
score = 5.55078
sequence = AACTGGATATTTTCACAGTT

Gene: MS0586: Excinuclease ABC subunit A
*
Actinobacillus succinogenes 130Z

Site:
position = -77
score = 5.0615
sequence = CACTGAATATTTTAACAGAT

Gene: Asuc_1879: Excinuclease ABC subunit A
*
Haemophilus somnus 2336

Site:
position = -97
score = 5.39886
sequence = AACTGGATATTTGCACAGTT

Gene: HSM_1049: Excinuclease ABC subunit A
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0844: Excinuclease ABC subunit A
 
Haemophilus ducreyi 35000HP

Gene: HD1286: Excinuclease ABC subunit A
 
Haemophilus parasuis SH0165

Gene: HAPS_0371: Excinuclease ABC subunit A
Excinuclease ABC subunit A
 
CRON 8.
radA
 
Haemophilus influenzae Rd KW20

Gene: HI1597: DNA repair protein RadA
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0319: DNA repair protein RadA
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0252: DNA repair protein RadA
 
Mannheimia succiniciproducens MBEL55E

Gene: MS2306: DNA repair protein RadA
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1080: DNA repair protein RadA
 
Haemophilus somnus 2336

Gene: HSM_0374: DNA repair protein RadA
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = 44
score = 4.86227
sequence = AGCTGTTTATTTACTCAGTA

Gene: APP7_0940: DNA repair protein RadA
*
Haemophilus ducreyi 35000HP

Site:
position = -65
score = 4.64684
sequence = GCCTGTGTATTTAGTCAGTA

Gene: HD1121: DNA repair protein RadA
*
Haemophilus parasuis SH0165

Site:
position = -67
score = 4.87242
sequence = CCCTGTGCATTTACACAGTG

Gene: HAPS_2014: DNA repair protein RadA
DNA repair protein RadA
 
CRON 9.
impA
*
Haemophilus influenzae Rd KW20

Site:
position = -88
score = 4.87716
sequence = CCCTGTATGAAATATCAGTA

Site:
position = -62
score = 4.88833
sequence = AACTGTACAAAAAAACAAGG

Gene: HI1546: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -37
score = 5.5587
sequence = CACTGTACAAAAACACAGTT

Site:
position = -63
score = 5.7005
sequence = TACTGTATATAACAACAGTA

Gene: NT05HA_0999: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -38
score = 5.76772
sequence = ACCTGTATAAATAACCAGTT

Site:
position = -64
score = 5.53257
sequence = ACCTGTATATAACAACAGTA

Gene: PM0892: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -66
score = 5.20144
sequence = ATCTGTTTGTTTATACAGTA

Site:
position = -40
score = 5.73018
sequence = ACCTGTATAAACAAACAGTT

Gene: MS0831: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Actinobacillus succinogenes 130Z

Site:
position = -54
score = 4.40776
sequence = AACTGTAAATTAAATCACAC

Site:
position = -80
score = 5.11713
sequence = CCCTGTTTAAGAAAACAGTA

Gene: Asuc_0946: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Haemophilus somnus 2336

Site:
position = -77
score = 5.46669
sequence = ATATGTATATAAAAACAGTA

Site:
position = -51
score = 5.67493
sequence = ACCTGTATAAATAATCAGTT

Gene: HSM_1015: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -61
score = 5.07607
sequence = CACTGTTTTTTTAATCAGTA

Site:
position = -36
score = 5.53856
sequence = ACCTGTATAAACACACAGTT

Site:
position = -101
score = 4.88052
sequence = TACTGGATATTTTTACAAAA

Gene: APP7_0382: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Haemophilus ducreyi 35000HP

Site:
position = -61
score = 5.22532
sequence = TACTGTTTTTTTAATCAGTA

Site:
position = -36
score = 4.77213
sequence = GCCTGTATAAATAACCATAT

Site:
position = -100
score = 5.15157
sequence = TACTGTATATTTTTACAAAA

Gene: HD1063: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
*
Haemophilus parasuis SH0165

Site:
position = -62
score = 5.30913
sequence = CACTGTGTGTTTAAACAGTA

Site:
position = -38
score = 5.54121
sequence = AACTGTATAAACACACAGAT

Site:
position = -102
score = 4.72386
sequence = ACCTGTAAAAATTTACACTA

Gene: HAPS_2271: SOS-response transcriptional repressors (RecA-mediated autopeptidases)
SOS-response transcriptional repressors (RecA-mediated autopeptidases)
 
CRON 10.
ssb
*
Haemophilus influenzae Rd KW20

Site:
position = -93
score = 5.13851
sequence = ATCTGTGCAAATATCCAGTT

Gene: HI0250: Single-stranded DNA-binding protein
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -110
score = 5.35645
sequence = AACTGTGCAAATATCCAGTT

Gene: NT05HA_2209: Single-stranded DNA-binding protein
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -112
score = 5.35645
sequence = AACTGTGCAAATATCCAGTT

Gene: PM1950: Single-stranded DNA-binding protein
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -92
score = 5.15819
sequence = AACTGTGAAAATATCCAGTT

Gene: MS0585: Single-stranded DNA-binding protein
*
Actinobacillus succinogenes 130Z

Site:
position = -94
score = 4.64688
sequence = ATCTGTTAAAATATTCAGTG

Gene: Asuc_1880: Single-stranded DNA-binding protein
*2
Haemophilus somnus 2336

Site:
position = -101
score = 5.35645
sequence = AACTGTGCAAATATCCAGTT

Gene: HSM_1048: Single-stranded DNA-binding protein

Gene: HSM_1745: Single-stranded DNA-binding protein
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -99
score = 5.44826
sequence = AACTGTACAAAATATCAGTT

Gene: APP7_0845: Single-stranded DNA-binding protein
*
Haemophilus ducreyi 35000HP

Site:
position = -96
score = 4.92962
sequence = AGCTGTACAAAATATCAGTT

Gene: HD1285: Single-stranded DNA-binding protein
*
Haemophilus parasuis SH0165

Site:
position = -191
score = 5.44826
sequence = AACTGTACAAAATATCAGTT

Gene: HAPS_0372: Single-stranded DNA-binding protein
Single-stranded DNA-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD