Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 186 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 21 17
Vibrio vulnificus CMCP6 25 18
Vibrio harveyi ATCC BAA-1116 27 20
Vibrio parahaemolyticus RIMD 2210633 22 18
Vibrio shilonii AK1 24 17
Vibrio splendidus LGP32 19 16
Vibrio fischeri ES114 17 14
Vibrio salmonicida LFI1238 17 14
Vibrio angustum S14 17 13
Photobacterium profundum SS9 16 12
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mutH
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -174
score = 4.07562
sequence = TACTGTTTATTGATCCATAC

Gene: VC0668: DNA mismatch repair endonuclease MutH
*
Vibrio vulnificus CMCP6

Site:
position = -163
score = 4.63327
sequence = TACTGTTTATTGATCCATGA

Gene: VV1_0521: DNA mismatch repair endonuclease MutH
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -162
score = 4.64305
sequence = CCCTGTTTATTCATCCAGCC

Gene: VIBHAR_00966: DNA mismatch repair endonuclease MutH
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -162
score = 4.64305
sequence = CCCTGTTTATTCATCCAGCC

Gene: VP0518: DNA mismatch repair endonuclease MutH
*
Vibrio shilonii AK1

Site:
position = -177
score = 4.92901
sequence = CACTGATTATTCATACAGCA

Gene: VSAK1_11158: DNA mismatch repair endonuclease MutH
*
Vibrio splendidus LGP32

Site:
position = -115
score = 4.86828
sequence = CCCTGTTTATTTATCCACTA

Gene: VS_0522: DNA mismatch repair endonuclease MutH
*
Vibrio fischeri ES114

Site:
position = -140
score = 4.92501
sequence = CACTGTATATGGATCCAGAA

Gene: VF_0455: DNA mismatch repair endonuclease MutH
*
Vibrio salmonicida LFI1238

Site:
position = -137
score = 5.3528
sequence = CACTGTATATAGATCCAGAA

Gene: VSAL_I0568: DNA mismatch repair endonuclease MutH
*
Vibrio angustum S14

Site:
position = -165
score = 4.99209
sequence = GCCTGTCTATTTAAACAGTT

Gene: VAS14_07584: DNA mismatch repair endonuclease MutH
 
Photobacterium profundum SS9

Gene: PBPRA0576: DNA mismatch repair endonuclease MutH
DNA mismatch repair endonuclease MutH
 
CRON 2.
VC1191
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -39
score = 5.761
sequence = TACTGTATTTACATACAGCA

Gene: VC1191: Superfamily II DNA and RNA helicase
*
Vibrio vulnificus CMCP6

Site:
position = -39
score = 5.64468
sequence = TACTGTATACACATACAGCA

Gene: VV1_2796: Superfamily II DNA and RNA helicase
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -105
score = 5.64468
sequence = TACTGTATACACATACAGCA

Gene: VIBHAR_02055: Superfamily II DNA and RNA helicase
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -39
score = 5.64468
sequence = TACTGTATACACATACAGCA

Gene: VP1264: Superfamily II DNA and RNA helicase
*
Vibrio shilonii AK1

Site:
position = -204
score = 5.05126
sequence = TACAGTATTCTTATACAGTA

Site:
position = -39
score = 5.64468
sequence = TACTGTATACACATACAGCA

Gene: VSAK1_06160: Superfamily II DNA and RNA helicase
*
Vibrio splendidus LGP32

Site:
position = 78
score = 5.64468
sequence = TACTGTATACACATACAGCA

Gene: VS_1206: Superfamily II DNA and RNA helicase
*
Vibrio fischeri ES114

Site:
position = -43
score = 5.40131
sequence = TACTGTATAAATACACACTG

Gene: VF_1493: Superfamily II DNA and RNA helicase
*
Vibrio salmonicida LFI1238

Site:
position = -21
score = 5.40131
sequence = TACTGTATAAATACACACTG

Gene: VSAL_I1693: Superfamily II DNA and RNA helicase
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Superfamily II DNA and RNA helicase
 
CRON 3.
xerD
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2419: Site-specific recombinase XerD
 
Vibrio vulnificus CMCP6

Gene: VV1_0530: Site-specific recombinase XerD
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -32
score = 5.31738
sequence = TACTGTAAATATAAACAGAT

Gene: VIBHAR_00956: Site-specific recombinase XerD
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0509: Site-specific recombinase XerD
*
Vibrio shilonii AK1

Site:
position = -21
score = 5.24511
sequence = TACTGTATAAACATCCAAGA

Gene: VSAK1_11208: Site-specific recombinase XerD
 
Vibrio splendidus LGP32

Gene: VS_0512: Site-specific recombinase XerD
*
Vibrio fischeri ES114

Site:
position = -51
score = 4.99869
sequence = TACTGTAATTCTAACCAGTG

Gene: VF_0448: Site-specific recombinase XerD
*
Vibrio salmonicida LFI1238

Site:
position = -45
score = 5.21354
sequence = TACTGTAATTCTAACCAGTA

Gene: VSAL_I0562: Site-specific recombinase XerD
*
Vibrio angustum S14

Site:
position = -55
score = 4.54076
sequence = TACTGTGTTTTTATCCATGT

Gene: VAS14_07634: Site-specific recombinase XerD
*
Photobacterium profundum SS9

Site:
position = -78
score = 4.41322
sequence = TACTGTGTTTATATCCATGC

Gene: PBPRA0566: Site-specific recombinase XerD
Site-specific recombinase XerD
dsbC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2418: Thiol:disulfide interchange protein
 
Vibrio vulnificus CMCP6

Gene: VV1_0529: Thiol:disulfide interchange protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00957: Thiol:disulfide interchange protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0510: Thiol:disulfide interchange protein
 2
Vibrio shilonii AK1

Gene: VSAK1_11203: Thiol:disulfide interchange protein

Gene: VSAK1_11198: Thiol:disulfide interchange protein
 
Vibrio splendidus LGP32

Gene: VS_0513: Thiol:disulfide interchange protein
 
Vibrio fischeri ES114

Gene: VF_0449: Thiol:disulfide interchange protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0563: Thiol:disulfide interchange protein
 
Vibrio angustum S14

Gene: VAS14_07629: Thiol:disulfide interchange protein
 
Photobacterium profundum SS9

Gene: PBPRA0567: Thiol:disulfide interchange protein
Thiol:disulfide interchange protein
recJ
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2417: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio vulnificus CMCP6

Gene: VV1_0528: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00958: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0511: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio shilonii AK1

Gene: VSAK1_11193: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio splendidus LGP32

Gene: VS_0514: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio fischeri ES114

Gene: VF_0450: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0564: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Vibrio angustum S14

Gene: VAS14_07624: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
Photobacterium profundum SS9

Gene: PBPRA0568: Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
Single-stranded-DNA-specific exonuclease RecJ (EC 3.1.-.-)
 
CRON 4.
uvrB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1018: Excinuclease ABC subunit B
*
Vibrio vulnificus CMCP6

Site:
position = -48
score = 5.31307
sequence = GAGTGTATATTTATACAGTT

Gene: VV1_3092: Excinuclease ABC subunit B
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -46
score = 4.83342
sequence = AGGTGTATATATATACAGCC

Gene: VIBHAR_02961: Excinuclease ABC subunit B
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -74
score = 4.9601
sequence = AGGTGTATATATATACAGCG

Gene: VP2100: Excinuclease ABC subunit B
 2
Vibrio shilonii AK1

Gene: VSAK1_03660: Excinuclease ABC subunit B

Gene: VSAK1_06550: Excinuclease ABC subunit B
*
Vibrio splendidus LGP32

Site:
position = -35
score = 4.99543
sequence = ACCTGATTAAAAAAACAGTA

Gene: VS_0980: Excinuclease ABC subunit B
 
Vibrio fischeri ES114

Gene: VF_0936: Excinuclease ABC subunit B
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1873: Excinuclease ABC subunit B
 2
Vibrio angustum S14

Gene: VAS14_15759: Excinuclease ABC subunit B

Gene: VAS14_05553: Excinuclease ABC subunit B
 
Photobacterium profundum SS9

Gene: PBPRA1118: Excinuclease ABC subunit B
Excinuclease ABC subunit B
 
CRON 5.
intIA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -40
score = 5.91946
sequence = TACTGTACAAATAACCAGTT

Gene: VCA0291: Integron integrase IntI4
*
Vibrio vulnificus CMCP6

Site:
position = -75
score = 4.26177
sequence = GGCTGTATATATACACATAT

Gene: VV1_2401: Integron integrase IntI4
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -30
score = 5.6887
sequence = AACTGTATAAACAACCAGTC

Gene: VIBHAR_02003: Integron integrase IntI4
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -30
score = 5.08349
sequence = ACCTGTATAAATAAACAGAC

Gene: VP1865: Integron integrase IntI4
*
Vibrio shilonii AK1

Site:
position = -32
score = 5.38103
sequence = AACTGTACACAAACACAGTA

Gene: VSAK1_25360: Integron integrase IntI4
*
Vibrio splendidus LGP32

Site:
position = -29
score = 5.18548
sequence = TCATGTACATATAACCAGTT

Gene: VS_1890: Integron integrase IntI4
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Integron integrase IntI4
 
CRON 6.
imuA
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -28
score = 5.81761
sequence = TACTGTATGTATATACAGGT

Gene: VV1_2987: Predicted RecA/RadA recombinase
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -29
score = 5.63035
sequence = TACTGTAAATATATACAGGT

Gene: VIBHAR_02866: Predicted RecA/RadA recombinase
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -29
score = 5.88268
sequence = TACTGTATTTATATACAGGT

Gene: VP2034: Predicted RecA/RadA recombinase
*
Vibrio shilonii AK1

Site:
position = -27
score = 5.86424
sequence = TACTGTACATATATACAGGT

Gene: VSAK1_26830: Predicted RecA/RadA recombinase
*
Vibrio splendidus LGP32

Site:
position = -28
score = 6.06561
sequence = TACTGTATAAATATACAGGT

Gene: VS_1042: Predicted RecA/RadA recombinase
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Predicted RecA/RadA recombinase
imuB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_2988: DNA polymerase-like protein PA0670
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02867: DNA polymerase-like protein PA0670
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2035: DNA polymerase-like protein PA0670
 
Vibrio shilonii AK1

Gene: VSAK1_26835: DNA polymerase-like protein PA0670
 
Vibrio splendidus LGP32

Gene: VS_1041: DNA polymerase-like protein PA0670
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
DNA polymerase-like protein PA0670
dnaE2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_2989: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02868: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2036: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Vibrio shilonii AK1

Gene: VSAK1_26840: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Vibrio splendidus LGP32

Gene: VS_1040: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 7.
VC1368
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -60
score = 5.81335
sequence = AACTGTATTAAAAAACAGTA

Site:
position = -10
score = 4.74844
sequence = TGCTGTAATTATGTACAGTG

Gene: VC1368: Conserved hypothetical protein
*
Vibrio vulnificus CMCP6

Site:
position = -39
score = 5.39453
sequence = TACTGAGTATACATACAGTT

Site:
position = -88
score = 5.52879
sequence = GACTGTATAAATGAACAGTA

Gene: VV1_2297: Conserved hypothetical protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -39
score = 6.00745
sequence = TACTGTATATGTATACAGTA

Gene: VIBHAR_02527: Conserved hypothetical protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -39
score = 5.96978
sequence = TACTGTTTTTATATACAGTA

Gene: VP1428: Conserved hypothetical protein
*
Vibrio shilonii AK1

Site:
position = -37
score = 5.2528
sequence = TACTGGTTGTACATACAGCA

Site:
position = -65
score = 5.61801
sequence = TACTGGATATTCATACAGCA

Gene: VSAK1_25105: Conserved hypothetical protein
 
Vibrio splendidus LGP32

Gene: VS_1790: Conserved hypothetical protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Conserved hypothetical protein
 
CRON 8.
umuD
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -29
score = 5.93004
sequence = AACTGTATATATGTACAGTT

Gene: VV1_0390: DNA polymerase V, subunit UmuD
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -26
score = 6.33839
sequence = TACTGTATATATAAACAGTA

Gene: VIBHAR_p08270: DNA polymerase V, subunit UmuD
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio fischeri ES114

Site:
position = -27
score = 5.2138
sequence = CGCTGTACTTATATACAGTG

Gene: VF_1269: DNA polymerase V, subunit UmuD
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -10
score = 5.88678
sequence = AACTGTATAAATGTACAGTT

Gene: VAS14_12359: DNA polymerase V, subunit UmuD
*
Photobacterium profundum SS9

Site:
position = -4
score = 5.41228
sequence = AACTGTGCATACATACAGTG

Gene: PBPRB0973: DNA polymerase V, subunit UmuD
DNA polymerase V, subunit UmuD
umuC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_0391: DNA polymerase V, subunit UmuC
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_p08269: DNA polymerase V, subunit UmuC
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_12354: DNA polymerase V, subunit UmuC
 
Photobacterium profundum SS9

Gene: PBPRB0972: DNA polymerase V, subunit UmuC
DNA polymerase V, subunit UmuC
 
CRON 9.
recG
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -65
score = 5.03263
sequence = TCCTGTACAAAAACACAGCT

Gene: VC2711: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*2
Vibrio vulnificus CMCP6

Site:
position = -65
score = 4.73978
sequence = TCCTGTACAAAAACACAGCC

Gene: VV1_0854: ATP-dependent DNA helicase RecG (EC 3.6.1.-)

Gene: VV1_0855: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -65
score = 5.03263
sequence = TCCTGTACAAAAACACAGCT

Gene: VIBHAR_00625: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -65
score = 5.03263
sequence = TCCTGTACAAAAACACAGCT

Gene: VP0157: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Vibrio shilonii AK1

Site:
position = -64
score = 5.67315
sequence = AACTGTACAAAAAGACAGTA

Gene: VSAK1_09763: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
*
Vibrio splendidus LGP32

Site:
position = -52
score = 5.16613
sequence = GCCTGTACAAAAATCCAGTA

Gene: VS_0158: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
Vibrio fischeri ES114

Gene: VF_2460: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2910: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
Vibrio angustum S14

Gene: VAS14_21732: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
Photobacterium profundum SS9

Gene: PBPRA0187: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
ATP-dependent DNA helicase RecG (EC 3.6.1.-)
 
CRON 10.
dinB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -30
score = 5.76819
sequence = TACTGTTTATGTATACAGTA

Gene: VC2287: DNA polymerase IV (EC 2.7.7.7)
*
Vibrio vulnificus CMCP6

Site:
position = -37
score = 5.11805
sequence = TACTGTGTTTTTGTCCAGTT

Gene: VV1_1830: DNA polymerase IV (EC 2.7.7.7)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03264: DNA polymerase IV (EC 2.7.7.7)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -31
score = 5.64967
sequence = TACTGTATTTTTAACCAGTG

Gene: VP2342: DNA polymerase IV (EC 2.7.7.7)
*
Vibrio shilonii AK1

Site:
position = -24
score = 6.20361
sequence = AACTGTATAAATAAACAGTT

Gene: VSAK1_12155: DNA polymerase IV (EC 2.7.7.7)
*
Vibrio splendidus LGP32

Site:
position = -41
score = 5.93456
sequence = TACTGTTTATAAATACAGTT

Gene: VS_0702: DNA polymerase IV (EC 2.7.7.7)
*
Vibrio fischeri ES114

Site:
position = -27
score = 5.57126
sequence = AACTGTGTTTTTATACAGTT

Gene: VF_0734: DNA polymerase IV (EC 2.7.7.7)
*2
Vibrio salmonicida LFI1238

Site:
position = -68
score = 5.79745
sequence = AACTGTGTATTTATACAGTT

Gene: VSAL_I0957: DNA polymerase IV (EC 2.7.7.7)

Site:
position = -132
score = 5.77174
sequence = GACTGTATATTTAAACAGTT

Gene: VSAL_I0965: DNA polymerase IV (EC 2.7.7.7)
*
Vibrio angustum S14

Site:
position = -30
score = 5.65073
sequence = AGCTGTATGTATAAACAGTA

Gene: VAS14_16776: DNA polymerase IV (EC 2.7.7.7)
*
Photobacterium profundum SS9

Site:
position = -64
score = 6.07698
sequence = TACTGTATATAAAAACAGTT

Gene: PBPRA0832: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 11.
rmuC
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -56
score = 5.48136
sequence = AACTGGACATTTATCCAGTG

Gene: VC0082: DNA recombination protein RmuC
*
Vibrio vulnificus CMCP6

Site:
position = -67
score = 5.69621
sequence = AACTGGACATTTATCCAGTA

Gene: VV1_0910: DNA recombination protein RmuC
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -67
score = 5.48136
sequence = AACTGGACATTTATCCAGTG

Gene: VIBHAR_00561: DNA recombination protein RmuC
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -67
score = 5.48136
sequence = AACTGGACATTTATCCAGTG

Gene: VP0094: DNA recombination protein RmuC
*
Vibrio shilonii AK1

Site:
position = -170
score = 5.27746
sequence = ATCTGGACATTTATCCAGTA

Gene: VSAK1_13165: DNA recombination protein RmuC
*
Vibrio splendidus LGP32

Site:
position = -68
score = 5.69621
sequence = AACTGGACATTTATCCAGTA

Gene: VS_0097: DNA recombination protein RmuC
*
Vibrio fischeri ES114

Site:
position = -62
score = 5.69621
sequence = AACTGGACATTTATCCAGTA

Gene: VF_0044: DNA recombination protein RmuC
*
Vibrio salmonicida LFI1238

Site:
position = -62
score = 5.69621
sequence = AACTGGACATTTATCCAGTA

Gene: VSAL_I2995: DNA recombination protein RmuC
*
Vibrio angustum S14

Site:
position = -73
score = 5.34265
sequence = AGCTGGACATTTATCCAGTA

Gene: VAS14_22754: DNA recombination protein RmuC
*
Photobacterium profundum SS9

Site:
position = -68
score = 5.38549
sequence = TGCTGGACATTTATCCAGTA

Gene: PBPRA0115: DNA recombination protein RmuC
DNA recombination protein RmuC
 
CRON 12.
lexA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -25
score = 5.59141
sequence = AACTGTATAAAAAGACAGGT

Site:
position = -45
score = 4.96964
sequence = CACTGGATATACTCACAGTC

Gene: VC0092: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio vulnificus CMCP6

Site:
position = -45
score = 5.44471
sequence = TACTGGATATACTCACAGTT

Site:
position = -25
score = 5.59141
sequence = AACTGTATAAAAAGACAGGT

Gene: VV1_1166: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -25
score = 5.59141
sequence = AACTGTATAAAAAGACAGGT

Site:
position = -45
score = 5.44471
sequence = TACTGGATATACTCACAGTT

Gene: VIBHAR_00268: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -25
score = 5.59141
sequence = AACTGTATAAAAAGACAGGT

Site:
position = -45
score = 5.44471
sequence = TACTGGATATACTCACAGTT

Gene: VP2945: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio shilonii AK1

Site:
position = -25
score = 5.66447
sequence = AACTGTATAAACAGACAGGT

Site:
position = -45
score = 5.44471
sequence = TACTGGATATACTCACAGTT

Gene: VSAK1_12472: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio splendidus LGP32

Site:
position = -25
score = 5.59141
sequence = AACTGTATAAAAAGACAGGT

Site:
position = -45
score = 5.15185
sequence = TACTGGATATACTCACAGTC

Gene: VS_3006: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio fischeri ES114

Site:
position = -25
score = 5.66447
sequence = AACTGTATAAACAGACAGGT

Site:
position = -45
score = 5.086
sequence = AGCTGTATATACTCACAGTG

Gene: VF_2442: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio salmonicida LFI1238

Site:
position = -25
score = 5.5251
sequence = CACTGTATAAACAGACAGGT

Site:
position = -45
score = 5.25217
sequence = AGCTGTATATACTCACAGTT

Gene: VSAL_I2893: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Vibrio angustum S14

Site:
position = -25
score = 5.59141
sequence = AACTGTATAAAAAGACAGGT

Site:
position = -45
score = 5.09633
sequence = CACTGGATATACTCACAGTG

Gene: VAS14_21837: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Photobacterium profundum SS9

Site:
position = -65
score = 5.31025
sequence = GACTGTATAAACAAACAGGG

Site:
position = -85
score = 5.31117
sequence = CACTGGATATACTCACAGTA

Gene: PBPRA0165: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
 
CRON 13.
ruvA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -71
score = 5.17668
sequence = TACTGGCTATCCATCCAGTT

Gene: VC1846: Holliday junction DNA helicase RuvA
*
Vibrio vulnificus CMCP6

Site:
position = -63
score = 5.42845
sequence = AACTGGATGTCTATCCAGTT

Gene: VV1_2159: Holliday junction DNA helicase RuvA
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -6
score = 5.11864
sequence = GACTGGATGTCTATCCAGTT

Gene: VIBHAR_01600: Holliday junction DNA helicase RuvA
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -63
score = 5.11864
sequence = GACTGGATGTCTATCCAGTT

Gene: VP1051: Holliday junction DNA helicase RuvA
*
Vibrio shilonii AK1

Site:
position = -66
score = 5.3772
sequence = AACTGGATACCTATCCAGTT

Gene: VSAK1_00385: Holliday junction DNA helicase RuvA
*
Vibrio splendidus LGP32

Site:
position = -67
score = 5.58643
sequence = AACTGGATAAGTATCCAGTT

Gene: VS_1107: Holliday junction DNA helicase RuvA
*
Vibrio fischeri ES114

Site:
position = -66
score = 5.76256
sequence = TACTGGATATCTATCCAGTT

Gene: VF_0951: Holliday junction DNA helicase RuvA
*
Vibrio salmonicida LFI1238

Site:
position = -66
score = 5.76256
sequence = TACTGGATATCTATCCAGTT

Gene: VSAL_I1888: Holliday junction DNA helicase RuvA
*
Vibrio angustum S14

Site:
position = -66
score = 5.42845
sequence = AACTGGATGTCTATCCAGTT

Gene: VAS14_18066: Holliday junction DNA helicase RuvA
*
Photobacterium profundum SS9

Site:
position = -65
score = 5.00963
sequence = TGCTGGATATCCATCCAGCA

Gene: PBPRA1116: Holliday junction DNA helicase RuvA
Holliday junction DNA helicase RuvA
ruvB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1845: Holliday junction DNA helicase RuvB
 2
Vibrio vulnificus CMCP6

Gene: VV1_2161: Holliday junction DNA helicase RuvB

Gene: VV1_2160: Holliday junction DNA helicase RuvB
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01601: Holliday junction DNA helicase RuvB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1052: Holliday junction DNA helicase RuvB
 
Vibrio shilonii AK1

Gene: VSAK1_00390: Holliday junction DNA helicase RuvB
 
Vibrio splendidus LGP32

Gene: VS_1108: Holliday junction DNA helicase RuvB
 
Vibrio fischeri ES114

Gene: VF_0952: Holliday junction DNA helicase RuvB
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1889: Holliday junction DNA helicase RuvB
 
Vibrio angustum S14

Gene: VAS14_18071: Holliday junction DNA helicase RuvB
 
Photobacterium profundum SS9

Gene: PBPRA1117: Holliday junction DNA helicase RuvB
Holliday junction DNA helicase RuvB
 
CRON 14.
uvrA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -85
score = 5.67925
sequence = AACTGTTTTTTTATCCAGTA

Gene: VC0394: Excinuclease ABC subunit A
*
Vibrio vulnificus CMCP6

Site:
position = -88
score = 5.67925
sequence = AACTGTTTTTTTATCCAGTA

Gene: VV1_1427: Excinuclease ABC subunit A
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -86
score = 5.30842
sequence = TACTGTTTTTTTGTCCAGTA

Gene: VIBHAR_03708: Excinuclease ABC subunit A
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -85
score = 5.30842
sequence = TACTGTTTTTTTGTCCAGTA

Gene: VP2712: Excinuclease ABC subunit A
*
Vibrio shilonii AK1

Site:
position = -84
score = 5.3458
sequence = ACCTGTTTTTTTATCCAGTA

Gene: VSAK1_08166: Excinuclease ABC subunit A
*
Vibrio splendidus LGP32

Site:
position = -84
score = 5.7221
sequence = TACTGTTTTTTTATCCAGTA

Gene: VS_0320: Excinuclease ABC subunit A
*
Vibrio fischeri ES114

Site:
position = -90
score = 5.53989
sequence = CACTGTTTTTTTATCCAGTA

Gene: VF_0341: Excinuclease ABC subunit A
*
Vibrio salmonicida LFI1238

Site:
position = -88
score = 5.7221
sequence = TACTGTTTTTTTATCCAGTA

Gene: VSAL_I0447: Excinuclease ABC subunit A
*
Vibrio angustum S14

Site:
position = -87
score = 4.95924
sequence = TACTGTGTTTTTACTCAGTA

Gene: VAS14_19446: Excinuclease ABC subunit A
*
Photobacterium profundum SS9

Site:
position = -91
score = 5.44717
sequence = TACTGTATCTTTATACAGCA

Gene: PBPRA3290: Excinuclease ABC subunit A
Excinuclease ABC subunit A
 
CRON 15.
uvrD
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -28
score = 5.13539
sequence = TTATGTATAAATAACCAGTG

Gene: VC0190: ATP-dependent DNA helicase II
*
Vibrio vulnificus CMCP6

Site:
position = -30
score = 5.79402
sequence = TTCTGTATAAATAACCAGTA

Gene: VV1_0949: ATP-dependent DNA helicase II
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -29
score = 5.35024
sequence = TTATGTATAAATAACCAGTA

Gene: VIBHAR_00351: ATP-dependent DNA helicase II
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -27
score = 5.35024
sequence = TTATGTATAAATAACCAGTA

Gene: VP3013: ATP-dependent DNA helicase II
*
Vibrio shilonii AK1

Site:
position = -30
score = 5.30739
sequence = ATATGTATAAATAACCAGTA

Gene: VSAK1_24239: ATP-dependent DNA helicase II
*
Vibrio splendidus LGP32

Site:
position = -33
score = 5.2356
sequence = TTATGTATAAATACCCAGTA

Gene: VS_3084: ATP-dependent DNA helicase II
*
Vibrio fischeri ES114

Site:
position = -27
score = 5.17783
sequence = ACATGTATAAATAACCAGTG

Gene: VF_0068: ATP-dependent DNA helicase II
*
Vibrio salmonicida LFI1238

Site:
position = -27
score = 5.17783
sequence = ACATGTATAAATAACCAGTG

Gene: VSAL_I0222: ATP-dependent DNA helicase II
*
Vibrio angustum S14

Site:
position = -27
score = 5.43893
sequence = CATTGTATAAATAACCAGTA

Gene: VAS14_22899: ATP-dependent DNA helicase II
*
Photobacterium profundum SS9

Site:
position = -27
score = 5.43893
sequence = CATTGTATAAATAACCAGTA

Gene: PBPRA3513: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 16.
yebG
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -49
score = 5.85979
sequence = AACTGTATAAACAGCCAGTT

Gene: VC2326: SOS regulon DNA damage-inducible protein
*
Vibrio vulnificus CMCP6

Site:
position = -54
score = 5.64441
sequence = AGCTGTATAAACACACAGTA

Gene: VV1_1791: SOS regulon DNA damage-inducible protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -53
score = 5.83541
sequence = AACTGTATAAAAAGCCAGTA

Gene: VIBHAR_03306: SOS regulon DNA damage-inducible protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -47
score = 5.83541
sequence = AACTGTATAAAAAGCCAGTA

Gene: VP2379: SOS regulon DNA damage-inducible protein
*
Vibrio shilonii AK1

Site:
position = -57
score = 5.57209
sequence = ATCTGTATAAACAGACAGTA

Gene: VSAK1_08581: SOS regulon DNA damage-inducible protein
*
Vibrio splendidus LGP32

Site:
position = -48
score = 5.62056
sequence = AACTGTATAAAAAGCCAGTG

Gene: VS_0670: SOS regulon DNA damage-inducible protein
*
Vibrio fischeri ES114

Site:
position = -41
score = 5.50538
sequence = TACTGTATAAAACACCAGTT

Gene: VF_0577: SOS regulon DNA damage-inducible protein
*
Vibrio salmonicida LFI1238

Site:
position = -41
score = 5.50538
sequence = TACTGTATAAAACACCAGTT

Gene: VSAL_I0676: SOS regulon DNA damage-inducible protein
*
Vibrio angustum S14

Site:
position = -44
score = 5.95131
sequence = TACTGTATAAACAGCCAGTA

Gene: VAS14_20761: SOS regulon DNA damage-inducible protein
*
Photobacterium profundum SS9

Site:
position = -38
score = 5.52352
sequence = TACTGTATAAGCAGCCAGTA

Gene: PBPRA3003: SOS regulon DNA damage-inducible protein
SOS regulon DNA damage-inducible protein
 
CRON 17.
topB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -84
score = 5.51335
sequence = TACTGGTTAAATTTACAGTT

Gene: VC2043: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio vulnificus CMCP6

Site:
position = -87
score = 5.75784
sequence = AACTGTCTATACATACAGTT

Gene: VV1_3130: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -84
score = 5.05334
sequence = TACTGTTTACCTGTACAGTT

Gene: VIBHAR_03041: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -85
score = 5.73735
sequence = TACTGTTCATTTATACAGTT

Gene: VP2149: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio shilonii AK1

Site:
position = -90
score = 5.52833
sequence = AACTGGCTATTTATACAGTT

Gene: VSAK1_03504: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio splendidus LGP32

Site:
position = -85
score = 5.98156
sequence = AACTGTATAAACAACCAGTT

Gene: VS_0940: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio fischeri ES114

Site:
position = -29
score = 5.31483
sequence = AACTGTCTATTCATACAGGT

Gene: VF_1641: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio salmonicida LFI1238

Site:
position = -57
score = 4.90115
sequence = AACTGTCTATTCGTACAGGT

Gene: VSAL_I2155: DNA topoisomerase III (EC 5.99.1.2)
*
Vibrio angustum S14

Site:
position = -86
score = 5.6407
sequence = AACTGGTTTTATATCCAGTA

Gene: VAS14_05738: DNA topoisomerase III (EC 5.99.1.2)
*
Photobacterium profundum SS9

Site:
position = -88
score = 5.22896
sequence = AACTGTTGTTATATCCAGTA

Gene: PBPRA2590: DNA topoisomerase III (EC 5.99.1.2)
DNA topoisomerase III (EC 5.99.1.2)
 
CRON 18.
rstA
*2
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -89
score = 3.97129
sequence = GGCTGTTTTTTTGTACATTA

Gene: VC1463: RstA phage-related replication protein

Site:
position = -89
score = 3.97129
sequence = GGCTGTTTTTTTGTACATTA

Gene: VC1454: RstA phage-related replication protein
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
RstA phage-related replication protein
rstB
 2
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1453: RstB phage-related integrase

Gene: VC1462: RstB phage-related integrase
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
RstB phage-related integrase
 
CRON 19.
recN
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -26
score = 4.72585
sequence = TATTGGTTAATCATACAGGT

Site:
position = -66
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Site:
position = -44
score = 5.97019
sequence = AACTGTTTAAACATACAGTA

Gene: VC0852: DNA repair protein RecN
*
Vibrio vulnificus CMCP6

Site:
position = -46
score = 5.73765
sequence = TACTGAATTTATATACAGTA

Site:
position = -68
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Gene: VV1_0367: DNA repair protein RecN
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -46
score = 5.46196
sequence = TACTGTTTTCTTATACAGTA

Site:
position = -68
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Gene: VIBHAR_01130: DNA repair protein RecN
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -46
score = 5.38264
sequence = TACTGTTCTCATATACAGTA

Site:
position = -68
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Gene: VP0648: DNA repair protein RecN
*
Vibrio shilonii AK1

Site:
position = -28
score = 4.91903
sequence = TAATGTTCATTTAAACAGGT

Site:
position = -68
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Site:
position = -46
score = 5.59797
sequence = TACTGAATTTACATACAGTA

Gene: VSAK1_11915: DNA repair protein RecN
*
Vibrio splendidus LGP32

Site:
position = -46
score = 5.16474
sequence = TACTGGGCTTATATACAGTG

Site:
position = -68
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Gene: VS_0646: DNA repair protein RecN
*
Vibrio fischeri ES114

Site:
position = -54
score = 5.32505
sequence = TACTGTGTCTATATACAGTG

Site:
position = -76
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Gene: VF_1998: DNA repair protein RecN
*
Vibrio salmonicida LFI1238

Site:
position = -47
score = 5.97109
sequence = TACTGTATAAAGAAACAGTA

Site:
position = -25
score = 5.51627
sequence = TACTGTTTCTTTATACAGTA

Gene: VSAL_I2475: DNA repair protein RecN
*
Vibrio angustum S14

Site:
position = -42
score = 5.50802
sequence = TACTGTATGTAAAAACAGGT

Site:
position = -64
score = 5.24027
sequence = TACTGGTTATGGATACAGTA

Gene: VAS14_07144: DNA repair protein RecN
*
Photobacterium profundum SS9

Site:
position = -64
score = 5.5753
sequence = TACTGTACGTAGATACAGTA

Site:
position = -42
score = 5.35013
sequence = TACTGTATGAAAACACAGGT

Gene: PBPRA0694: DNA repair protein RecN
DNA repair protein RecN
 
CRON 20.
recA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = 69
score = 5.42232
sequence = CACTGTACAAATCAACAGTA

Gene: VC0543: Recombinase A
*
Vibrio vulnificus CMCP6

Site:
position = -104
score = 5.42232
sequence = CACTGTACAAATCAACAGTA

Gene: VV1_1591: Recombinase A
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -89
score = 5.37569
sequence = CACTGTATGAATCAACAGTA

Gene: VIBHAR_03513: Recombinase A
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -110
score = 5.37569
sequence = CACTGTATGAATCAACAGTA

Gene: VP2550: Recombinase A
*
Vibrio shilonii AK1

Site:
position = -131
score = 5.37569
sequence = CACTGTATGAATCAACAGTA

Gene: VSAK1_02059: Recombinase A
*
Vibrio splendidus LGP32

Site:
position = -94
score = 5.37569
sequence = CACTGTATGAATCAACAGTA

Gene: VS_2596: Recombinase A
*
Vibrio fischeri ES114

Site:
position = -69
score = 5.74652
sequence = CACTGTACAAATAGACAGTA

Gene: VF_0535: Recombinase A
*
Vibrio salmonicida LFI1238

Site:
position = -69
score = 5.6999
sequence = CACTGTATGAATAGACAGTA

Gene: VSAL_I0634: Recombinase A
*
Vibrio angustum S14

Site:
position = -78
score = 5.6999
sequence = CACTGTATGAATAGACAGTA

Gene: VAS14_20496: Recombinase A
*
Photobacterium profundum SS9

Site:
position = -64
score = 5.6999
sequence = CACTGTATGAATAGACAGTA

Gene: PBPRA3068: Recombinase A
Recombinase A
recX
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0544: Regulatory protein RecX
 
Vibrio vulnificus CMCP6

Gene: VV1_1592: Regulatory protein RecX
*3
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03512: Regulatory protein RecX

Site:
position = -83
score = 5.02571
sequence = AGCTGTGTAAATAATCAGTA

Gene: VIBHAR_06801: Regulatory protein RecX

Site:
position = -83
score = 5.02571
sequence = AGCTGTGTAAATAATCAGTA

Gene: VIBHAR_02827: Regulatory protein RecX
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2549: Regulatory protein RecX
 
Vibrio shilonii AK1

Gene: VSAK1_02064: Regulatory protein RecX
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Regulatory protein RecX
 
CRON 21.
VP2946
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -41
score = 5.17256
sequence = ACCTGTCTTTTTATACAGTT

Site:
position = -21
score = 5.15929
sequence = AACTGTGAGTATATCCAGTA

Gene: VP2946: Hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD