Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AraR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 4 1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 5 3
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 5 2
Lactobacillus reuteri JCM 1112 4 1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K 3 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 4 1
Oenococcus oeni PSU-1 1 1
Pediococcus pentosaceus ATCC 25745 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
araA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1740: L-arabinose isomerase (EC 5.3.1.4)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -105
score = 5.93927
sequence = TGAATTGTACGGACAAATAT

Gene: LAF_1554: L-arabinose isomerase (EC 5.3.1.4)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3554: L-arabinose isomerase (EC 5.3.1.4)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0470: L-arabinose isomerase (EC 5.3.1.4)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1856: L-arabinose isomerase (EC 5.3.1.4)
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -136
score = 5.69916
sequence = TGACTTATACGGACAAATGT

Gene: LEUM_0852: L-arabinose isomerase (EC 5.3.1.4)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0165: L-arabinose isomerase (EC 5.3.1.4)
L-arabinose isomerase (EC 5.3.1.4)
araE
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -212
score = 4.44202
sequence = AAATTAATCCGAATAACAAA

Site:
position = -183
score = 6.14982
sequence = TGATTTATGCGTACAAATAT

Gene: LVIS_1743: L-arabinose-proton symporter
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -153
score = 4.40856
sequence = ATATTGTTCAGTATAATTTA

Gene: LAF_1555: L-arabinose-proton symporter
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -166
score = 6.49899
sequence = TGATTTATACGTATAAATAT

Site:
position = -195
score = 4.74142
sequence = TAATTTGTGCTGATAAAACA

Gene: lp_3557: L-arabinose-proton symporter
*
Lactobacillus reuteri JCM 1112

Site:
position = -103
score = 6.35746
sequence = TGATTTATCCGTACAAATAT

Gene: LAR_0467: L-arabinose-proton symporter
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -250
score = 5.68574
sequence = ATAATTATTCGAATAAATAA

Site:
position = -150
score = 4.64194
sequence = ATATTGATTCGAATCAAAAA

Site:
position = -121
score = 4.65112
sequence = TGATTTATTCGAATGAAAGT

Gene: LSA1860: L-arabinose-proton symporter
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0853: L-arabinose-proton symporter
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -121
score = 4.45335
sequence = AAATTCATCCTAACAAATTT

Site:
position = -89
score = 6.06911
sequence = TGACTTGTCCGTATAAATAT

Gene: PEPE_0162: L-arabinose-proton symporter
L-arabinose-proton symporter
araK
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1742: Ribulokinase (EC 2.7.1.16)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -77
score = 5.93377
sequence = TGATTTATACGGACAAAAAA

Gene: LAF_1558: Ribulokinase (EC 2.7.1.16)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3556: Ribulokinase (EC 2.7.1.16)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0468: Ribulokinase (EC 2.7.1.16)
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1859: Ribulokinase (EC 2.7.1.16)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0854: Ribulokinase (EC 2.7.1.16)
*
Oenococcus oeni PSU-1

Site:
position = -149
score = 4.96613
sequence = TGATTTATATGTACGAATGT

Site:
position = -179
score = 5.02332
sequence = AAATTCATACGTAAAACTAA

Site:
position = -192
score = 4.53017
sequence = TTATTTTTACAAAAAATTCA

Gene: OEOE_0227: Ribulokinase (EC 2.7.1.16)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0163: Ribulokinase (EC 2.7.1.16)
Ribulokinase (EC 2.7.1.16)
araD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1741: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus casei ATCC 334

Gene: LSEI_2731: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1557: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3555: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0469: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus rhamnosus GG

Gene: LGG_02723: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1857: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Lactobacillus salivarius subsp. salivarius UCC118
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1992: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)

Gene: LEUM_0855: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0164: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1744: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1556: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -234
score = 5.16295
sequence = TTATTGATGCGGATAAATTG

Gene: lp_3558: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0473: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1861: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0851: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Oenococcus oeni PSU-1

Gene: OEOE_0226: Arabinoside utilization transcriptional repressor AraR, GntR family
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0157: Arabinoside utilization transcriptional repressor AraR, GntR family
Arabinoside utilization transcriptional repressor AraR, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD