Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DVU1964/DVU1967 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028 1 1
Desulfovibrio desulfuricans G20 4 1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 4 2
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 5 2
Desulfovibrio vulgaris Hildenborough 4 1
Desulfovibrio vulgaris str. Miyazaki F 4 1
Lawsonia intracellularis PHE/MN1-00
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Dbac_3187
 
Desulfohalobium retbaense DSM 5692
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -17
score = 4.38081
sequence = AATCATTCGAGATTATTATGAAG

Gene: Dbac_3187: Transcriptional regulator, Rrf2 family
 
Desulfovibrio desulfuricans G20

Gene: Dde_3112: Transcriptional regulator, Rrf2 family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -269
score = 4.0991
sequence = TTAAATATCAACGCAATATGTAG

Gene: Desal_0351: Transcriptional regulator, Rrf2 family
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, Rrf2 family
 
CRON 2.
Desal_0350
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_2176: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -585
score = 5.61709
sequence = ATTCAGATTAATTTAATCCGAAT

Site:
position = -570
score = 4.77215
sequence = ATCCGAATTAAAACAATCTGAAT

Site:
position = -491
score = 5.17011
sequence = TTCTAGACTTATTTAATCTAGAT

Site:
position = -476
score = 5.08174
sequence = ATCTAGATTAAAACAATCAGAAA

Gene: Desal_0350: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1368: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0145: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Lawsonia intracellularis PHE/MN1-00
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
DVU1968
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_0223: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -196
score = 4.7697
sequence = AAACATACTAGTTTAGTATTAAT

Gene: Ddes_1846: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio magneticus RS-1

Gene: DMR_13140: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0349: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1968: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0624: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Lawsonia intracellularis PHE/MN1-00
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
DVU1969
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_0222: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1847: hypothetical protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_13130: hypothetical protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0348: hypothetical protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1969: hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0625: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
hypothetical protein
DVU1970
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
 
Desulfovibrio desulfuricans G20

Gene: Dde_0221: response regulator receiver protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0844: response regulator receiver protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_13120: response regulator receiver protein
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0347: response regulator receiver protein
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1970: response regulator receiver protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0626: response regulator receiver protein
 
Lawsonia intracellularis PHE/MN1-00
response regulator receiver protein
DVU1967
 
Desulfohalobium retbaense DSM 5692
 
Desulfomicrobium baculatum DSM 4028
*
Desulfovibrio desulfuricans G20

Site:
position = -79
score = 4.70932
sequence = ATCTAGATAAATTAAATCCGCTT

Site:
position = -139
score = 5.63852
sequence = AATCAGACCAAACAAGTCTGGAT

Site:
position = -94
score = 5.53241
sequence = ATCCAGACTGTATTAATCTAGAT

Gene: Dde_0224: Transcriptional regulator, Rrf2 family
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -77
score = 4.68226
sequence = ATCATGAGTAAAGCAGTCTAAAT

Site:
position = -57
score = 4.5924
sequence = AATTAGACGTATCAAGTATGGTA

Gene: Ddes_0843: Transcriptional regulator, Rrf2 family
 
Desulfovibrio magneticus RS-1
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -104
score = 5.80736
sequence = ATTCAGACCAACTCAATCTGATA

Site:
position = -84
score = 4.76089
sequence = ATACAGATTAATTAAGATTGAAA

Gene: DVU1967: Transcriptional regulator, Rrf2 family
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -155
score = 5.94012
sequence = ATTCATACGAAATTAATCTGATT

Site:
position = -110
score = 4.06798
sequence = AACGAAATTGCATCAATATACAT

Gene: DvMF_0623: Transcriptional regulator, Rrf2 family
 
Lawsonia intracellularis PHE/MN1-00
Transcriptional regulator, Rrf2 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD