Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Desulfuromonadales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Geobacter metallireducens GS-15
Geobacter sulfurreducens PCA 4 1
Geobacter uraniumreducens Rf4 1 1
Geobacter sp. FRC-32
Geobacter sp. M21 1 1
Geobacter lovleyi SZ 6 1
Pelobacter propionicus DSM 2379 5 2
Pelobacter carbinolicus str. DSM 2380 8 3
Desulfuromonas acetoxidans DSM 684 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp_mod
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
*
Pelobacter propionicus DSM 2379

Site:
position = -107
score = 5.65357
sequence = CATCGTTATTACTAATACTATATAACTACG

Gene: Ppro_1541: predicted TonB-dependent outer memberane transporter for molybdate
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -128
score = 5.40921
sequence = CTTCGCTATATTGCGGCGATGATAACGATT

Gene: Pcar_2397: predicted TonB-dependent outer memberane transporter for molybdate
*
Desulfuromonas acetoxidans DSM 684

Site:
position = -86
score = 5.67411
sequence = TTGCGTTGTATAGCGTGGCATATAGCGTAA

Gene: Dace_2070: predicted TonB-dependent outer memberane transporter for molybdate
predicted TonB-dependent outer memberane transporter for molybdate
Dace2069
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1540: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -107
score = 5.26048
sequence = GTTCGCTATATTCCGCGATTAACAACGTAT

Gene: Pcar_2396: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_2069: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Dace_2068
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1539: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_2395: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_2068: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Dace_2067
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1538: Core component Dace_2067 of predicted ECF transporter
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_2394: Core component Dace_2067 of predicted ECF transporter
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_2067: Core component Dace_2067 of predicted ECF transporter
Core component Dace_2067 of predicted ECF transporter
 
CRON 2.
modE
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
*
Geobacter sp. M21

Site:
position = -136
score = 5.19866
sequence = TTTCTCCATATAGGTTGTGCTATAACGATG

Gene: GM21_2529: Molybdate-responsive transcriptional regulator ModE
*
Geobacter lovleyi SZ

Site:
position = -97
score = 5.70744
sequence = AAGCGTTATTTAGATCTATACATAACGTCA

Gene: Glov_0447: Molybdate-responsive transcriptional regulator ModE
 
Pelobacter propionicus DSM 2379
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
Molybdate-responsive transcriptional regulator ModE
modD
 
Geobacter metallireducens GS-15
*
Geobacter sulfurreducens PCA

Site:
position = -160
score = 5.75024
sequence = TATCGTTATGTCATGAAGGTTATAGCGTTT

Gene: GSU2963: Molybdenum transport system protein ModD
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ

Gene: Glov_0448: Molybdenum transport system protein ModD
 
Pelobacter propionicus DSM 2379
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_2604: Molybdenum transport system protein ModD
Molybdenum transport system protein ModD
modA
 
Geobacter metallireducens GS-15

Gene: Gmet_0512: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Geobacter sulfurreducens PCA

Gene: GSU2962: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Geobacter uraniumreducens Rf4

Site:
position = -261
score = 5.36294
sequence = ATGCGTTATAATGTGCAAACTATAACGCTT

Gene: Gura_3323: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Geobacter sp. FRC-32

Gene: Geob_3689: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Geobacter sp. M21

Gene: GM21_1616: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: GM21_4076: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Geobacter lovleyi SZ

Gene: Glov_0449: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Glov_0450: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*2
Pelobacter propionicus DSM 2379

Site:
position = -104
score = 5.11846
sequence = GGTCGCTATATATCAAAAAACACTGCGCTC

Gene: Ppro_1963: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Ppro_1459: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*3
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0775: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Site:
position = -115
score = 5.17165
sequence = ATTCGTTATATTTTCCCGGAGATAGCGCCC

Gene: Pcar_2087: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Pcar_2084: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1673: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Dace_0994: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Geobacter metallireducens GS-15

Gene: Gmet_0513: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Geobacter sulfurreducens PCA

Gene: GSU2961: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Geobacter uraniumreducens Rf4

Gene: Gura_3322: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Geobacter sp. FRC-32

Gene: Geob_3688: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Geobacter sp. M21

Gene: GM21_1617: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Geobacter lovleyi SZ

Gene: Glov_0451: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1458: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 4
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0776: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Pcar_2108: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Pcar_2086: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Pcar_0230: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1101: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Geobacter metallireducens GS-15

Gene: Gmet_0514: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Geobacter sulfurreducens PCA

Gene: GSU2960: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Geobacter uraniumreducens Rf4

Gene: Gura_3321: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Geobacter sp. FRC-32

Gene: Geob_3687: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Geobacter sp. M21

Gene: GM21_1618: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Geobacter lovleyi SZ

Gene: Glov_0452: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1457: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 4
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0777: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Pcar_2109: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Pcar_2085: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Pcar_0231: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1100: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD