Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 3 2
Caulobacter segnis ATCC 21756
Caulobacter sp. K31 3 3
Phenylobacterium zucineum HLK1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
*
Caulobacter crescentus CB15

Site:
position = -49
score = 6.46275
sequence = TTATGTAGTTTGGCTGCATAA

Gene: CC0328: Molybdate ABC transporter, permease protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3825: Molybdate ABC transporter, permease protein
*
Caulobacter sp. K31

Site:
position = -89
score = 6.46275
sequence = TTAGGCACTTGAACTACATAA

Gene: Caul_1837: Molybdate ABC transporter, permease protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2286: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modB
 
Caulobacter crescentus CB15

Gene: CC0329: Molybdate ABC transporter, permease protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3824: Molybdate ABC transporter, permease protein
*
Caulobacter sp. K31

Site:
position = -102
score = 5.42771
sequence = TTATGTAGTCAAGATACATAT

Gene: Caul_2732: Molybdate ABC transporter, permease protein
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2285: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
 
CRON 2.
modE
*
Caulobacter crescentus CB15

Site:
position = 23
score = 6.46275
sequence = TTATGCAGCCAAACTACATAA

Gene: CC0327: Molybdate-responsive transcriptional regulator ModE
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -64
score = 5.42771
sequence = ATATGTATCTTGACTACATAA

Gene: Caul_2731: Molybdate-responsive transcriptional regulator ModE
 
Phenylobacterium zucineum HLK1
Molybdate-responsive transcriptional regulator ModE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD