Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444 3 1
Sphingopyxis alaskensis RB2256
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1 3 1
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -53
score = 5.11765
sequence = ACTGTATACTTCGGAACATAGC

Gene: Saro_0212: Molybdate ABC transporter, substrate-binding protein
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0550: Molybdate ABC transporter, substrate-binding protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33060: Molybdate ABC transporter, substrate-binding protein
*
Sphingomonas wittichii RW1

Site:
position = -54
score = 5.15115
sequence = GCCATATATTATGGGATATAGC

Gene: Swit_4418: Molybdate ABC transporter, substrate-binding protein
 
Zymomonas mobilis subsp. mobilis ZM4
Molybdate ABC transporter, substrate-binding protein
modB
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0213: Molybdate ABC transporter, permease protein
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0551: Molybdate ABC transporter, permease protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33080: Molybdate ABC transporter, permease protein
 
Sphingomonas wittichii RW1

Gene: Swit_4417: Molybdate ABC transporter, permease protein
 
Zymomonas mobilis subsp. mobilis ZM4
Molybdate ABC transporter, permease protein
modC
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0214: Molybdate ABC transporter, ATP-binding protein
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0552: Molybdate ABC transporter, ATP-binding protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-33090: Molybdate ABC transporter, ATP-binding protein
 
Sphingomonas wittichii RW1

Gene: Swit_4416: Molybdate ABC transporter, ATP-binding protein
 
Zymomonas mobilis subsp. mobilis ZM4
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD