Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510 3 1
Rhodospirillum centenum SW 3 1
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0704: Molybdate ABC transporter, substrate-binding protein
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010295: Molybdate ABC transporter, substrate-binding protein
 
Magnetospirillum magneticum AMB-1

Gene: amb2951: Molybdate ABC transporter, substrate-binding protein
*
Azospirillum sp. B510

Site:
position = -21
score = 5.42796
sequence = GCTGTATCCGTTTGAATATATA

Gene: AZL_015260: Molybdate ABC transporter, substrate-binding protein
*
Rhodospirillum centenum SW

Site:
position = -41
score = 5.4721
sequence = GATGTATTCTCATGGATACATC

Gene: RC1_2219: Molybdate ABC transporter, substrate-binding protein
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1579: Molybdate ABC transporter, substrate-binding protein
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_2126: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0703: Molybdate ABC transporter, permease protein
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03008378: Molybdate ABC transporter, permease protein

Gene: Magn03002548: Molybdate ABC transporter, permease protein
 
Magnetospirillum magneticum AMB-1

Gene: amb3404: Molybdate ABC transporter, permease protein
 
Azospirillum sp. B510

Gene: AZL_015250: Molybdate ABC transporter, permease protein
 
Rhodospirillum centenum SW

Gene: RC1_2218: Molybdate ABC transporter, permease protein
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1580: Molybdate ABC transporter, permease protein
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Molybdate ABC transporter, permease protein
modC
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A0702: Molybdate ABC transporter, ATP-binding protein
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03006196: Molybdate ABC transporter, ATP-binding protein

Gene: Magn03008379: Molybdate ABC transporter, ATP-binding protein
 
Magnetospirillum magneticum AMB-1

Gene: amb3403: Molybdate ABC transporter, ATP-binding protein
 
Azospirillum sp. B510

Gene: AZL_015240: Molybdate ABC transporter, ATP-binding protein
 
Rhodospirillum centenum SW

Gene: RC1_2216: Molybdate ABC transporter, ATP-binding protein
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1581: Molybdate ABC transporter, ATP-binding protein
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_2124: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD