Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222 3 1
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654 3 1
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217 3 1
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3 3 1
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Rhodobacter sphaeroides 2.4.1
*
Paracoccus denitrificans PD1222

Site:
position = -37
score = 5.21367
sequence = GTTATGTCCGTTTGAACATAAT

Gene: Pden_2665: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -11
score = 5.64415
sequence = GATATGTTTCAGTGAACATATC

Gene: RB2654_14140: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -41
score = 5.64415
sequence = GATATGTTTCAGTGAACATATC

Site:
position = -88
score = 5.53801
sequence = GATGTATCTGAGTGAACATAAC

Gene: ROS217_12636: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
*
Silicibacter pomeroyi DSS-3

Site:
position = -24
score = 4.96038
sequence = GATATTTCCGCCCAGACATATC

Gene: SPO0699: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_2666: Molybdate ABC transporter, permease protein
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14135: Molybdate ABC transporter, permease protein
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12641: Molybdate ABC transporter, permease protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO0698: Molybdate ABC transporter, permease protein
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Molybdate ABC transporter, permease protein
modC
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_2667: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14125: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12646: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3

Gene: SPO0697: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD