Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 3 1
Rhizobium sp. NGR234 3 1
Rhizobium leguminosarum bv. viciae 3841 3 1
Rhizobium etli CFN 42 3 1
Agrobacterium tumefaciens str. C58 (Cereon) 3 1
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099 3 1
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1 3 1
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571 3 1
Xanthobacter autotrophicus Py2 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
*
Sinorhizobium meliloti 1021

Site:
position = -82
score = 5.37574
sequence = ATTGTATTTCTACGAATATAGC

Gene: SMc03196: Molybdate ABC transporter, substrate-binding protein
*
Rhizobium sp. NGR234

Site:
position = -82
score = 5.47122
sequence = ATTGTATTTCTGCGGATATAGC

Gene: NGR_c29840: Molybdate ABC transporter, substrate-binding protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -84
score = 5.99397
sequence = GTTATATTTTCTTGGATATATC

Site:
position = -41
score = 5.4663
sequence = GTTATATTCGTCGCAATATTTC

Gene: RL4685: Molybdate ABC transporter, substrate-binding protein
*
Rhizobium etli CFN 42

Site:
position = -42
score = 5.57296
sequence = GTTATATTCCTTGAAATATTTC

Site:
position = -85
score = 5.42439
sequence = GTTATATTTTCTTCGATACATC

Gene: RHE_CH04071: Molybdate ABC transporter, substrate-binding protein
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -81
score = 5.0692
sequence = GATATATCCTTGAAAATATAAT

Site:
position = -39
score = 5.64396
sequence = GTTATATTCATCGGAATACATC

Gene: Atu2561: Molybdate ABC transporter, substrate-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2722: Molybdate ABC transporter, substrate-binding protein
*
Mesorhizobium loti MAFF303099

Site:
position = -71
score = 5.90887
sequence = GTTATATTCATGCGGATATATC

Gene: mll1465: Molybdate ABC transporter, substrate-binding protein
 
Brucella melitensis 16M

Gene: BMEII0005: Molybdate ABC transporter, substrate-binding protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4717: Molybdate ABC transporter, substrate-binding protein
 2
Bradyrhizobium japonicum USDA 110

Gene: blr8160: Molybdate ABC transporter, substrate-binding protein

Gene: blr6951: Molybdate ABC transporter, substrate-binding protein
*
Bradyrhizobium sp. BTAi1

Site:
position = -111
score = 5.68397
sequence = GATATATACGAATGGATATAGC

Gene: BBta_2080: Molybdate ABC transporter, substrate-binding protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0340: Molybdate ABC transporter, substrate-binding protein
*
Azorhizobium caulinodans ORS 571

Site:
position = -41
score = 5.39579
sequence = GCTATATATGAGGAGATATAAC

Gene: AZC_2368: Molybdate ABC transporter, substrate-binding protein
*
Xanthobacter autotrophicus Py2

Site:
position = -38
score = 4.22954
sequence = GCTGTATATGAACGAGCATACC

Gene: Xaut_3202: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Sinorhizobium meliloti 1021

Gene: SMc03197: Molybdate ABC transporter, permease protein
 
Rhizobium sp. NGR234

Gene: NGR_c29850: Molybdate ABC transporter, permease protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4686: Molybdate ABC transporter, permease protein
 
Rhizobium etli CFN 42

Gene: RHE_CH04072: Molybdate ABC transporter, permease protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2562: Molybdate ABC transporter, permease protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2721: Molybdate ABC transporter, permease protein
 
Mesorhizobium loti MAFF303099

Gene: mll1464: Molybdate ABC transporter, permease protein
 
Brucella melitensis 16M

Gene: BMEII0004: Molybdate ABC transporter, permease protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4716: Molybdate ABC transporter, permease protein
 3
Bradyrhizobium japonicum USDA 110

Gene: blr8161: Molybdate ABC transporter, permease protein

Gene: blr1719: Molybdate ABC transporter, permease protein

Gene: blr6952: Molybdate ABC transporter, permease protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2079: Molybdate ABC transporter, permease protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0339: Molybdate ABC transporter, permease protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2369: Molybdate ABC transporter, permease protein
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3201: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Sinorhizobium meliloti 1021

Gene: SMc03198: Molybdate ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_c29860: Molybdate ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4687: Molybdate ABC transporter, ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH04073: Molybdate ABC transporter, ATP-binding protein
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2563: Molybdate ABC transporter, ATP-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2720: Molybdate ABC transporter, ATP-binding protein
 
Mesorhizobium loti MAFF303099

Gene: mll1463: Molybdate ABC transporter, ATP-binding protein
 
Brucella melitensis 16M

Gene: BMEII0003: Molybdate ABC transporter, ATP-binding protein
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA4715: Molybdate ABC transporter, ATP-binding protein
 3
Bradyrhizobium japonicum USDA 110

Gene: blr8162: Molybdate ABC transporter, ATP-binding protein

Gene: bll1780: Molybdate ABC transporter, ATP-binding protein

Gene: blr6953: Molybdate ABC transporter, ATP-binding protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2078: Molybdate ABC transporter, ATP-binding protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0338: Molybdate ABC transporter, ATP-binding protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2370: Molybdate ABC transporter, ATP-binding protein
 
Xanthobacter autotrophicus Py2
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD