Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1
Thauera sp. MZ1T
Dechloromonas aromatica RCB 3 1
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Chromobacterium violaceum ATCC 12472
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9 5 1
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modE
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
*
Dechloromonas aromatica RCB

Site:
position = -149
score = 5.94273
sequence = CGCTATATACAACCATATGTAGCG

Site:
position = -38
score = 5.65066
sequence = CGTTATAGTGATTTGTATATAGAT

Gene: Daro_1477: Molybdate-responsive transcriptional regulator ModE
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
*
Laribacter hongkongensis HLHK9

Site:
position = -28
score = 5.96967
sequence = CGTTATATAGTCGTGTATATTACG

Gene: LHK_02456: Molybdate-responsive transcriptional regulator ModE
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Molybdate-responsive transcriptional regulator ModE
modA
 
Azoarcus sp. EbN1

Gene: ebA2721: Molybdate ABC transporter, substrate-binding protein
 
Thauera sp. MZ1T

Gene: Tmz1t_0536: Molybdate ABC transporter, substrate-binding protein
 
Dechloromonas aromatica RCB

Gene: Daro_1476: Molybdate ABC transporter, substrate-binding protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1283: Molybdate ABC transporter, substrate-binding protein
 
Chromobacterium violaceum ATCC 12472

Gene: CV3726: Molybdate ABC transporter, substrate-binding protein
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02457: Molybdate ABC transporter, substrate-binding protein
 
Methylobacillus flagellatus KT

Gene: Mfla_1391: Molybdate ABC transporter, substrate-binding protein
 
Methylotenera mobilis JLW8

Gene: Mmol_2128: Molybdate ABC transporter, substrate-binding protein
 
Methylophilales bacterium HTCC2181
Molybdate ABC transporter, substrate-binding protein
modX
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02458: Predicted molibdenum binding protein
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Predicted molibdenum binding protein
modB
 
Azoarcus sp. EbN1

Gene: ebA2720: Molybdate ABC transporter, permease protein
 
Thauera sp. MZ1T

Gene: Tmz1t_0537: Molybdate ABC transporter, permease protein
 
Dechloromonas aromatica RCB

Gene: Daro_2783: Molybdate ABC transporter, permease protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1284: Molybdate ABC transporter, permease protein
 
Chromobacterium violaceum ATCC 12472

Gene: CV3727: Molybdate ABC transporter, permease protein
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02459: Molybdate ABC transporter, permease protein
 
Methylobacillus flagellatus KT

Gene: Mfla_1392: Molybdate ABC transporter, permease protein
 
Methylotenera mobilis JLW8

Gene: Mmol_2129: Molybdate ABC transporter, permease protein
 
Methylophilales bacterium HTCC2181
Molybdate ABC transporter, permease protein
modC
 
Azoarcus sp. EbN1

Gene: ebA2719: Molybdate ABC transporter, ATP-binding protein
 
Thauera sp. MZ1T

Gene: Tmz1t_0538: Molybdate ABC transporter, ATP-binding protein
 
Dechloromonas aromatica RCB

Gene: Daro_2784: Molybdate ABC transporter, ATP-binding protein
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_1285: Molybdate ABC transporter, ATP-binding protein
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9

Gene: LHK_02460: Molybdate ABC transporter, ATP-binding protein
 
Methylobacillus flagellatus KT

Gene: Mfla_1393: Molybdate ABC transporter, ATP-binding protein
 
Methylotenera mobilis JLW8

Gene: Mmol_2130: Molybdate ABC transporter, ATP-binding protein
 
Methylophilales bacterium HTCC2181
Molybdate ABC transporter, ATP-binding protein
modD
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB

Gene: Daro_1475: Molybdenum transport system protein ModD
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Molybdenum transport system protein ModD
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD