Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 3 1
Acidovorax sp. JS42 4 2
Comamonas testosteroni KF-1 4 2
Delftia acidovorans SPH-1 4 2
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236 4 2
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2 3 1
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -13
score = 7.34801
sequence = CGCTATTCAGTCGATGAATAGCG

Gene: Aave_2028: Molybdate ABC transporter, substrate-binding protein
*
Acidovorax sp. JS42

Site:
position = -34
score = 7.00141
sequence = CGCTATTCATCAATGGAATAGCG

Gene: Ajs_3124: Molybdate ABC transporter, substrate-binding protein
*
Comamonas testosteroni KF-1

Site:
position = -13
score = 7.31235
sequence = CGCTATTCAAACAATGAATAGCG

Gene: CtesDRAFT_2992: Molybdate ABC transporter, substrate-binding protein
*
Delftia acidovorans SPH-1

Site:
position = 26
score = 6.75665
sequence = CGCTATTCACCAACGGAATAGCG

Gene: Daci_1520: Molybdate ABC transporter, substrate-binding protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2037: Molybdate ABC transporter, substrate-binding protein
 
Polaromonas sp. JS666

Gene: Bpro_0161: Molybdate ABC transporter, substrate-binding protein
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -90
score = 6.45766
sequence = CGCTATTCCTAATTAGAATAGCG

Gene: Rfer_2858: Molybdate ABC transporter, substrate-binding protein
 
Variovorax paradoxus S110

Gene: Vapar_4069: Molybdate ABC transporter, substrate-binding protein
*
Verminephrobacter eiseniae EF01-2

Site:
position = -44
score = 7.37256
sequence = CGCTATTCCTTCAATGAATAGCG

Gene: Veis_2888: Molybdate ABC transporter, substrate-binding protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3713: Molybdate ABC transporter, substrate-binding protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_1356: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2027: Molybdate ABC transporter, permease protein
 
Acidovorax sp. JS42

Gene: Ajs_3125: Molybdate ABC transporter, permease protein
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2993: Molybdate ABC transporter, permease protein
 
Delftia acidovorans SPH-1

Gene: Daci_1519: Molybdate ABC transporter, permease protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2040: Molybdate ABC transporter, permease protein
 
Polaromonas sp. JS666

Gene: Bpro_0162: Molybdate ABC transporter, permease protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2859: Molybdate ABC transporter, permease protein
 
Variovorax paradoxus S110

Gene: Vapar_4070: Molybdate ABC transporter, permease protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2887: Molybdate ABC transporter, permease protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3714: Molybdate ABC transporter, permease protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_1357: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2026: Molybdate ABC transporter, ATP-binding protein
 
Acidovorax sp. JS42

Gene: Ajs_3126: Molybdate ABC transporter, ATP-binding protein
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2994: Molybdate ABC transporter, ATP-binding protein
 
Delftia acidovorans SPH-1

Gene: Daci_1518: Molybdate ABC transporter, ATP-binding protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2041: Molybdate ABC transporter, ATP-binding protein
 
Polaromonas sp. JS666

Gene: Bpro_0163: Molybdate ABC transporter, ATP-binding protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2860: Molybdate ABC transporter, ATP-binding protein
 
Variovorax paradoxus S110

Gene: Vapar_4068: Molybdate ABC transporter, ATP-binding protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2886: Molybdate ABC transporter, ATP-binding protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3715: Molybdate ABC transporter, ATP-binding protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_1358: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
modE
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2030: Molybdate-responsive transcriptional regulator ModE
*
Acidovorax sp. JS42

Site:
position = -13
score = 7.32779
sequence = CGCTATTCCATTGATGAATAGCG

Gene: Ajs_3123: Molybdate-responsive transcriptional regulator ModE
*
Comamonas testosteroni KF-1

Site:
position = -89
score = 7.05487
sequence = CGCTATTCATTGTTTGAATAGCG

Gene: CtesDRAFT_2991: Molybdate-responsive transcriptional regulator ModE
*
Delftia acidovorans SPH-1

Site:
position = -86
score = 7.03465
sequence = CGCTATTCCGTTGGTGAATAGCG

Gene: Daci_1521: Molybdate-responsive transcriptional regulator ModE
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -74
score = 6.86436
sequence = CGCTATTCTAATTAGGAATAGCG

Gene: Rfer_2857: Molybdate-responsive transcriptional regulator ModE
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4545: Molybdate-responsive transcriptional regulator ModE
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Molybdate-responsive transcriptional regulator ModE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD