Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 3 1
Burkholderia mallei ATCC 23344 3 1
Burkholderia sp. 383 3 1
Burkholderia cepacia AMMD 3 1
Burkholderia vietnamiensis G4 3 1
Burkholderia glumae BGR1
Burkholderia xenovorans LB400 6 2
Burkholderia phymatum STM815 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
*
Burkholderia pseudomallei K96243

Site:
position = -58
score = 5.67795
sequence = CGTTATAACCTCGCGTATATTACG

Gene: BPSS1786: Molybdate ABC transporter, substrate-binding protein
*
Burkholderia mallei ATCC 23344

Site:
position = -58
score = 5.67795
sequence = CGTTATAACCTCGCGTATATTACG

Gene: BMAA0299: Molybdate ABC transporter, substrate-binding protein
*
Burkholderia sp. 383

Site:
position = 17
score = 6.17954
sequence = CGTTATAACCCGCCCTATATTACG

Gene: Bcep18194_B2236: Molybdate ABC transporter, substrate-binding protein
*
Burkholderia cepacia AMMD

Site:
position = -57
score = 5.94973
sequence = CGTTATAACCTCCCCTATATTACG

Gene: Bamb_3228: Molybdate ABC transporter, substrate-binding protein
*2
Burkholderia vietnamiensis G4

Gene: Bcep1808_6031: Molybdate ABC transporter, substrate-binding protein

Site:
position = -57
score = 6.17954
sequence = CGTTATAACCGGCGCTATATTACG

Gene: Bcep1808_4236: Molybdate ABC transporter, substrate-binding protein
 
Burkholderia glumae BGR1
*2
Burkholderia xenovorans LB400

Site:
position = -72
score = 5.78142
sequence = CGTTATAACCTTTCATATATTACG

Gene: Bxe_B2848: Molybdate ABC transporter, substrate-binding protein

Gene: Bxe_B1480: Molybdate ABC transporter, substrate-binding protein
*
Burkholderia phymatum STM815

Site:
position = -67
score = 5.28571
sequence = CGCTGTAACCAGACATATATTACG

Gene: Bphy_4405: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Burkholderia pseudomallei K96243

Gene: BPSS1787: Molybdate ABC transporter, permease protein
 
Burkholderia mallei ATCC 23344

Gene: BMAA0298: Molybdate ABC transporter, permease protein
 
Burkholderia sp. 383

Gene: Bcep18194_B2237: Molybdate ABC transporter, permease protein
 
Burkholderia cepacia AMMD

Gene: Bamb_3227: Molybdate ABC transporter, permease protein
 2
Burkholderia vietnamiensis G4

Gene: Bcep1808_4235: Molybdate ABC transporter, permease protein

Gene: Bcep1808_6030: Molybdate ABC transporter, permease protein
 
Burkholderia glumae BGR1
*2
Burkholderia xenovorans LB400

Gene: Bxe_B2849: Molybdate ABC transporter, permease protein

Site:
position = -37
score = 5.10238
sequence = CGTTACGTCGTTCATTTCACAACG

Gene: Bxe_B1479: Molybdate ABC transporter, permease protein
 
Burkholderia phymatum STM815

Gene: Bphy_4404: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Burkholderia pseudomallei K96243

Gene: BPSS1788: Molybdate ABC transporter, ATP-binding protein
 
Burkholderia mallei ATCC 23344

Gene: BMAA0297: Molybdate ABC transporter, ATP-binding protein
 
Burkholderia sp. 383

Gene: Bcep18194_B2238: Molybdate ABC transporter, ATP-binding protein
 
Burkholderia cepacia AMMD

Gene: Bamb_3226: Molybdate ABC transporter, ATP-binding protein
 2
Burkholderia vietnamiensis G4

Gene: Bcep1808_4234: Molybdate ABC transporter, ATP-binding protein

Gene: Bcep1808_6032: Molybdate ABC transporter, ATP-binding protein
 
Burkholderia glumae BGR1
 2
Burkholderia xenovorans LB400

Gene: Bxe_B2850: Molybdate ABC transporter, ATP-binding protein

Gene: Bxe_B1481: Molybdate ABC transporter, ATP-binding protein
 
Burkholderia phymatum STM815

Gene: Bphy_4403: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD