Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1
Acinetobacter baumannii AB0057 3 1
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Acinetobacter sp. ADP1

Gene: ACIAD1901: Molybdate ABC transporter, substrate-binding protein
*
Acinetobacter baumannii AB0057

Site:
position = -56
score = 5.91849
sequence = AGCGCTATATTCTTAAGTATATATCGCT

Gene: AB57_1980: Molybdate ABC transporter, substrate-binding protein
 
Psychrobacter arcticum 273-4

Gene: Psyc_0617: Molybdate ABC transporter, substrate-binding protein
 
Psychrobacter sp. PRwf-1
Molybdate ABC transporter, substrate-binding protein
modB
 
Acinetobacter sp. ADP1

Gene: ACIAD1900: Molybdate ABC transporter, permease protein
 
Acinetobacter baumannii AB0057

Gene: AB57_1981: Molybdate ABC transporter, permease protein
 
Psychrobacter arcticum 273-4

Gene: Psyc_0618: Molybdate ABC transporter, permease protein
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0223: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Acinetobacter sp. ADP1

Gene: ACIAD1899: Molybdate ABC transporter, ATP-binding protein
 
Acinetobacter baumannii AB0057

Gene: AB57_1982: Molybdate ABC transporter, ATP-binding protein
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD