Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 3 1
Pseudomonas entomophila L48 3 1
Pseudomonas putida KT2440 3 1
Pseudomonas syringae pv. tomato str. DC3000 3 1
Pseudomonas fluorescens Pf-5 3 1
Pseudomonas mendocina ymp 3 1
Pseudomonas stutzeri A1501 4 1
Azotobacter vinelandii AvOP 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modE
 
Pseudomonas aeruginosa PAO1

Gene: PA0487: Molybdate-responsive transcriptional regulator ModE
 
Pseudomonas entomophila L48

Gene: PSEEN5123: Molybdate-responsive transcriptional regulator ModE
 
Pseudomonas putida KT2440

Gene: PP0360: Molybdate-responsive transcriptional regulator ModE
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0492: Molybdate-responsive transcriptional regulator ModE
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5695: Molybdate-responsive transcriptional regulator ModE
 
Pseudomonas mendocina ymp

Gene: Pmen_4091: Molybdate-responsive transcriptional regulator ModE
*
Pseudomonas stutzeri A1501

Site:
position = -168
score = 6.53993
sequence = CGCTATATACAAAACGATATAGCG

Gene: PST_1348: Molybdate-responsive transcriptional regulator ModE
*
Azotobacter vinelandii AvOP

Site:
position = -46
score = 4.74027
sequence = CTTTATATAAAACTGGATAAATAG

Site:
position = -164
score = 4.76064
sequence = CGCTATATCATTTGCACTATAAAT

Gene: Avin_50680: Molybdate-responsive transcriptional regulator ModE
Molybdate-responsive transcriptional regulator ModE
modA
*
Pseudomonas aeruginosa PAO1

Site:
position = -84
score = 5.80515
sequence = CGCTATATTCCAAAAGCCATAGCG

Gene: PA1863: Molybdate ABC transporter, substrate-binding protein
*
Pseudomonas entomophila L48

Site:
position = -55
score = 6.20263
sequence = CGCTATATATTCCACGACATAACG

Gene: PSEEN2286: Molybdate ABC transporter, substrate-binding protein
*
Pseudomonas putida KT2440

Site:
position = -46
score = 6.30689
sequence = CGCTATATAGTTAAGGCTATAACG

Gene: PP3828: Molybdate ABC transporter, substrate-binding protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -128
score = 6.90059
sequence = CGCTATATATTTAAATATATAGCG

Gene: PSPTO2973: Molybdate ABC transporter, substrate-binding protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -101
score = 6.42118
sequence = CGCTATATATTCCGCTATATAGCG

Gene: PFL_3412: Molybdate ABC transporter, substrate-binding protein
*
Pseudomonas mendocina ymp

Site:
position = -74
score = 6.01608
sequence = CGCTATATACAAGAAAACATAACG

Gene: Pmen_4339: Molybdate ABC transporter, substrate-binding protein
 
Pseudomonas stutzeri A1501

Gene: PST_1347: Molybdate ABC transporter, substrate-binding protein
 2
Azotobacter vinelandii AvOP

Gene: Avin_50670: Molybdate ABC transporter, substrate-binding protein

Gene: Avin_01300: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Pseudomonas aeruginosa PAO1

Gene: PA1862: Molybdate ABC transporter, permease protein
 
Pseudomonas entomophila L48

Gene: PSEEN2285: Molybdate ABC transporter, permease protein
 
Pseudomonas putida KT2440

Gene: PP3829: Molybdate ABC transporter, permease protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2974: Molybdate ABC transporter, permease protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3413: Molybdate ABC transporter, permease protein
 
Pseudomonas mendocina ymp

Gene: Pmen_4340: Molybdate ABC transporter, permease protein
 
Pseudomonas stutzeri A1501

Gene: PST_1346: Molybdate ABC transporter, permease protein
 2
Azotobacter vinelandii AvOP

Gene: Avin_50660: Molybdate ABC transporter, permease protein

Gene: Avin_01290: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Pseudomonas aeruginosa PAO1

Gene: PA1861: Molybdate ABC transporter, ATP-binding protein
 
Pseudomonas entomophila L48

Gene: PSEEN2284: Molybdate ABC transporter, ATP-binding protein
 
Pseudomonas putida KT2440

Gene: PP3830: Molybdate ABC transporter, ATP-binding protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2975: Molybdate ABC transporter, ATP-binding protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3414: Molybdate ABC transporter, ATP-binding protein
 
Pseudomonas mendocina ymp

Gene: Pmen_4341: Molybdate ABC transporter, ATP-binding protein
 
Pseudomonas stutzeri A1501

Gene: PST_1345: Molybdate ABC transporter, ATP-binding protein
 3
Azotobacter vinelandii AvOP

Gene: Avin_50650: Molybdate ABC transporter, ATP-binding protein

Gene: Avin_01580: Molybdate ABC transporter, ATP-binding protein

Gene: Avin_01280: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD