Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 2 1
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1 3 1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Hahella chejuensis KCTC 2396

Gene: HCH_02454: Molybdate ABC transporter, substrate-binding protein
 
Marinobacter aqueolei

Gene: Maqu_3545: Molybdate ABC transporter, substrate-binding protein
 
Marinobacter sp. ELB17

Gene: MELB17_02520: Molybdate ABC transporter, substrate-binding protein
 
Oceanobacter sp. RED65

Gene: RED65_16651: Molybdate ABC transporter, substrate-binding protein
 
Oceanospirillum sp. MED92

Gene: MED92_03712: Molybdate ABC transporter, substrate-binding protein
*
Marinomonas sp. MWYL1

Site:
position = -73
score = 6.57942
sequence = TTCGTTATATAGTTCAATATATAACGAA

Gene: Mmwyl1_0979: Molybdate ABC transporter, substrate-binding protein
 
Saccharophagus degradans 2-40

Gene: Sde_2846: Molybdate ABC transporter, substrate-binding protein
 
Teredinibacter turnerae T7901

Gene: TERTU_1534: Molybdate ABC transporter, substrate-binding protein
 
Cellvibrio japonicus Ueda107

Gene: CJA_0316: Molybdate ABC transporter, substrate-binding protein
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2677: Molybdate ABC transporter, substrate-binding protein
 
Reinekea sp. MED297

Gene: MED297_14650: Molybdate ABC transporter, substrate-binding protein
 
Alcanivorax borkumensis SK2

Gene: ABO_1254: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Hahella chejuensis KCTC 2396

Gene: HCH_02453: Molybdate ABC transporter, permease protein
 
Marinobacter aqueolei

Gene: Maqu_3546: Molybdate ABC transporter, permease protein
 
Marinobacter sp. ELB17

Gene: MELB17_02515: Molybdate ABC transporter, permease protein
 
Oceanobacter sp. RED65

Gene: RED65_16656: Molybdate ABC transporter, permease protein
 
Oceanospirillum sp. MED92

Gene: MED92_03707: Molybdate ABC transporter, permease protein
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0978: Molybdate ABC transporter, permease protein
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_1533: Molybdate ABC transporter, permease protein
 
Cellvibrio japonicus Ueda107

Gene: CJA_0317: Molybdate ABC transporter, permease protein
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2676: Molybdate ABC transporter, permease protein
 
Reinekea sp. MED297

Gene: MED297_14655: Molybdate ABC transporter, permease protein
 
Alcanivorax borkumensis SK2

Gene: ABO_1255: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Hahella chejuensis KCTC 2396

Gene: HCH_02452: Molybdate ABC transporter, ATP-binding protein
 
Marinobacter aqueolei

Gene: Maqu_3547: Molybdate ABC transporter, ATP-binding protein
 
Marinobacter sp. ELB17

Gene: MELB17_02510: Molybdate ABC transporter, ATP-binding protein
 
Oceanobacter sp. RED65

Gene: RED65_16661: Molybdate ABC transporter, ATP-binding protein
 
Oceanospirillum sp. MED92

Gene: MED92_03702: Molybdate ABC transporter, ATP-binding protein
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0977: Molybdate ABC transporter, ATP-binding protein
 
Saccharophagus degradans 2-40

Gene: Sde_2847: Molybdate ABC transporter, ATP-binding protein
 
Teredinibacter turnerae T7901

Gene: TERTU_1532: Molybdate ABC transporter, ATP-binding protein
 
Cellvibrio japonicus Ueda107

Gene: CJA_0318: Molybdate ABC transporter, ATP-binding protein
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2675: Molybdate ABC transporter, ATP-binding protein
 
Reinekea sp. MED297

Gene: MED297_14660: Molybdate ABC transporter, ATP-binding protein
 
Alcanivorax borkumensis SK2

Gene: ABO_1256: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
modE
*
Hahella chejuensis KCTC 2396

Site:
position = -80
score = 6.23599
sequence = AGCGTTATATAGAATACTATATAGCGCT

Gene: HCH_02455: Molybdate-responsive transcriptional regulator ModE
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0976: Molybdate-responsive transcriptional regulator ModE
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Molybdate-responsive transcriptional regulator ModE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD