Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20 10 5
Aggregatibacter aphrophilus NJ8700 12 4
Pasteurella multocida subsp. multocida str. Pm70 12 4
Mannheimia succiniciproducens MBEL55E 6 3
Actinobacillus succinogenes 130Z 6 3
Haemophilus somnus 2336
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
moaA
*
Haemophilus influenzae Rd KW20

Site:
position = -246
score = 6.84986
sequence = TTCATTATGTATTTTTTTATATAATTGA

Gene: HI1676: Molybdenum cofactor biosynthesis protein A
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -252
score = 6.88631
sequence = ATCGCTATATAAATTTATATATAATTGA

Gene: NT05HA_0848: Molybdenum cofactor biosynthesis protein A
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -266
score = 6.66102
sequence = AACGCTATATATTTTGTTATATAATTGA

Gene: PM0625: Molybdenum cofactor biosynthesis protein A
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -254
score = 6.18268
sequence = TCTGTTATATACATTTATATATAACTGA

Gene: MS1021: Molybdenum cofactor biosynthesis protein A
*
Actinobacillus succinogenes 130Z

Site:
position = -258
score = 6.56398
sequence = TTCGCTATAAAATTAAATATATAATTGA

Gene: Asuc_1677: Molybdenum cofactor biosynthesis protein A
 
Haemophilus somnus 2336

Gene: HSM_1509: Molybdenum cofactor biosynthesis protein A
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0732: Molybdenum cofactor biosynthesis protein A
 
Haemophilus ducreyi 35000HP

Gene: HD1392: Molybdenum cofactor biosynthesis protein A
 
Haemophilus parasuis SH0165

Gene: HAPS_0436: Molybdenum cofactor biosynthesis protein A
Molybdenum cofactor biosynthesis protein A
moaC
 
Haemophilus influenzae Rd KW20

Gene: HI1675: Molybdenum cofactor biosynthesis protein C
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0847: Molybdenum cofactor biosynthesis protein C
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0624: Molybdenum cofactor biosynthesis protein C
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1022: Molybdenum cofactor biosynthesis protein C
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1676: Molybdenum cofactor biosynthesis protein C
 
Haemophilus somnus 2336

Gene: HSM_1508: Molybdenum cofactor biosynthesis protein C
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0733: Molybdenum cofactor biosynthesis protein C
 
Haemophilus ducreyi 35000HP

Gene: HD1391: Molybdenum cofactor biosynthesis protein C
 
Haemophilus parasuis SH0165

Gene: HAPS_0437: Molybdenum cofactor biosynthesis protein C
Molybdenum cofactor biosynthesis protein C
moaD
 
Haemophilus influenzae Rd KW20

Gene: HI1674: Molybdopterin synthase sulfur carrier subunit
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0846: Molybdopterin synthase sulfur carrier subunit
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0623: Molybdopterin synthase sulfur carrier subunit
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1023: Molybdopterin synthase sulfur carrier subunit
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1675: Molybdopterin synthase sulfur carrier subunit
 
Haemophilus somnus 2336

Gene: HSM_1507: Molybdopterin synthase sulfur carrier subunit
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0734: Molybdopterin synthase sulfur carrier subunit
 
Haemophilus ducreyi 35000HP

Gene: HD1390: Molybdopterin synthase sulfur carrier subunit
 
Haemophilus parasuis SH0165

Gene: HAPS_0438: Molybdopterin synthase sulfur carrier subunit
Molybdopterin synthase sulfur carrier subunit
moaE
 
Haemophilus influenzae Rd KW20

Gene: HI1673: Molybdopterin synthase catalytic subunit
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0845: Molybdopterin synthase catalytic subunit
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0622: Molybdopterin synthase catalytic subunit
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1024: Molybdopterin synthase catalytic subunit
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1674: Molybdopterin synthase catalytic subunit
 
Haemophilus somnus 2336

Gene: HSM_1506: Molybdopterin synthase catalytic subunit
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0735: Molybdopterin synthase catalytic subunit
 
Haemophilus ducreyi 35000HP

Gene: HD1389: Molybdopterin synthase catalytic subunit
 
Haemophilus parasuis SH0165

Gene: HAPS_0439: Molybdopterin synthase catalytic subunit
Molybdopterin synthase catalytic subunit
 
CRON 2.
modA
*
Haemophilus influenzae Rd KW20

Site:
position = -101
score = 6.17428
sequence = AGCGTTATATATTTTACTAAATAATTTT

Gene: HI1693: Molybdate ABC transporter, substrate-binding protein
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -58
score = 6.03474
sequence = TTCGTTGTATAATTTGTGCTATATATAA

Gene: NT05HA_1098: Molybdate ABC transporter, substrate-binding protein
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -69
score = 6.73127
sequence = AACATTGTATAATTTTTTATATAAAGTT

Gene: PM0744: Molybdate ABC transporter, substrate-binding protein
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -46
score = 6.35712
sequence = TTCATTATATAATTGGATAAATAGCGAA

Gene: MS1342: Molybdate ABC transporter, substrate-binding protein
*
Actinobacillus succinogenes 130Z

Site:
position = -63
score = 5.956
sequence = TAAGTTATATAATTTATTACATATATCT

Gene: Asuc_1559: Molybdate ABC transporter, substrate-binding protein
 
Haemophilus somnus 2336

Gene: HSM_0342: Molybdate ABC transporter, substrate-binding protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0264: Molybdate ABC transporter, substrate-binding protein
 
Haemophilus ducreyi 35000HP

Gene: HD1823: Molybdate ABC transporter, substrate-binding protein
*
Haemophilus parasuis SH0165

Site:
position = -152
score = 6.62152
sequence = TTCGTTATATAATAGTTTATATATTGTT

Gene: HAPS_1456: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Haemophilus influenzae Rd KW20

Gene: HI1692: Molybdate ABC transporter, permease protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1097: Molybdate ABC transporter, permease protein
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0743: Molybdate ABC transporter, permease protein
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1341: Molybdate ABC transporter, permease protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0180: Molybdate ABC transporter, permease protein
 
Haemophilus somnus 2336

Gene: HSM_0343: Molybdate ABC transporter, permease protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0263: Molybdate ABC transporter, permease protein
 
Haemophilus ducreyi 35000HP

Gene: HD1824: Molybdate ABC transporter, permease protein
 
Haemophilus parasuis SH0165

Gene: HAPS_0813: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Haemophilus influenzae Rd KW20

Gene: HI1691: Molybdate ABC transporter, ATP-binding protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1096: Molybdate ABC transporter, ATP-binding protein
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0742: Molybdate ABC transporter, ATP-binding protein
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1340: Molybdate ABC transporter, ATP-binding protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0181: Molybdate ABC transporter, ATP-binding protein
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0262: Molybdate ABC transporter, ATP-binding protein
 
Haemophilus ducreyi 35000HP

Gene: HD1826: Molybdate ABC transporter, ATP-binding protein
 
Haemophilus parasuis SH0165

Gene: HAPS_0814: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
 
CRON 3.
momA
*
Haemophilus influenzae Rd KW20

Site:
position = -60
score = 6.75013
sequence = TTCATTATACAATTTTATATATATCGAT

Gene: HI1525: Predicted ABC transporter, substrate-binding protein
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -68
score = 6.53788
sequence = TTCATTATATTTATTTTTATATAACCAA

Gene: NT05HA_0272: Predicted ABC transporter, substrate-binding protein
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -68
score = 6.2946
sequence = TTCGATATATTACATTTTATATAATGAT

Gene: PM1108: Predicted ABC transporter, substrate-binding protein
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Predicted ABC transporter, substrate-binding protein
momB
 
Haemophilus influenzae Rd KW20

Gene: HI1475: Predicted ABC transporter, permease protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0273: Predicted ABC transporter, permease protein
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1109: Predicted ABC transporter, permease protein
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Predicted ABC transporter, permease protein
momC
 
Haemophilus influenzae Rd KW20

Gene: HI1474: Predicted ABC transporter, ATP-binding protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0274: Predicted ABC transporter, ATP-binding protein
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1110: Predicted ABC transporter, ATP-binding protein
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Predicted ABC transporter, ATP-binding protein
momD
 
Haemophilus influenzae Rd KW20

Gene: HI1473: Predicted pyrophosphorylase
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0275: Predicted pyrophosphorylase
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1111: Predicted pyrophosphorylase
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Predicted pyrophosphorylase
 
CRON 4.
ybgI
*
Haemophilus influenzae Rd KW20

Site:
position = -161
score = 6.46227
sequence = ATCGCTATAAATTTATGTATATAATGAA

Gene: HI0105: Conserved metal-binding protein
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -191
score = 6.40414
sequence = ATCGTTATATATTAAATTGTATAATGAA

Gene: NT05HA_0380: Conserved metal-binding protein
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -190
score = 5.87404
sequence = ACCATTATATAATAAAGTATATAATGAG

Gene: PM0183: Conserved metal-binding protein
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1464: Conserved metal-binding protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1068: Conserved metal-binding protein
 
Haemophilus somnus 2336

Gene: HSM_1003: Conserved metal-binding protein
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0671: Conserved metal-binding protein
 
Haemophilus ducreyi 35000HP

Gene: HD1471: Conserved metal-binding protein
 
Haemophilus parasuis SH0165

Gene: HAPS_0502: Conserved metal-binding protein
Conserved metal-binding protein
 
CRON 5.
modE
*
Haemophilus influenzae Rd KW20

Site:
position = -118
score = 5.87285
sequence = AACGTTATTTACTTGATTATATATTGAA

Gene: HI1694: Molybdate-responsive transcriptional regulator ModE
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1099: Molybdate-responsive transcriptional regulator ModE
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0746: Molybdate-responsive transcriptional regulator ModE
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -107
score = 5.48679
sequence = TTCGCTATTTATCCAATTATATAATGAA

Gene: MS1344: Molybdate-responsive transcriptional regulator ModE
*
Actinobacillus succinogenes 130Z

Site:
position = -118
score = 6.03819
sequence = TGCGTTATATAATTTAAGATATATGTAA

Gene: Asuc_1560: Molybdate-responsive transcriptional regulator ModE
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -119
score = 6.12387
sequence = AACAATATATAAACTATTATATAACGAA

Gene: HAPS_1455: Molybdate-responsive transcriptional regulator ModE
Molybdate-responsive transcriptional regulator ModE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD