Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio vulnificus CMCP6
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14 3 1
Photobacterium profundum SS9 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0726: Molybdate ABC transporter, substrate-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV20329: Molybdate ABC transporter, substrate-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05725: Molybdate ABC transporter, substrate-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0931: Molybdate ABC transporter, substrate-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_14847: Molybdate ABC transporter, substrate-binding protein
 
Vibrio splendidus LGP32

Gene: VS_II0723: Molybdate ABC transporter, substrate-binding protein
 
Vibrio fischeri ES114

Gene: VF_A0290: Molybdate ABC transporter, substrate-binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0782: Molybdate ABC transporter, substrate-binding protein
*
Vibrio angustum S14

Site:
position = -43
score = 7.64432
sequence = CGATATGTAGTTTACTATATATCG

Gene: VAS14_11339: Molybdate ABC transporter, substrate-binding protein
*
Photobacterium profundum SS9

Site:
position = -50
score = 7.32705
sequence = CGATATGTAGTAAGGTATATATCG

Gene: PBPRB1349: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0725: Molybdate ABC transporter, permease protein
 
Vibrio vulnificus CMCP6

Gene: VV20328: Molybdate ABC transporter, permease protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05726: Molybdate ABC transporter, permease protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0930: Molybdate ABC transporter, permease protein
 
Vibrio shilonii AK1

Gene: VSAK1_14842: Molybdate ABC transporter, permease protein
 
Vibrio splendidus LGP32

Gene: VS_II0724: Molybdate ABC transporter, permease protein
 
Vibrio fischeri ES114

Gene: VF_A0291: Molybdate ABC transporter, permease protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0781: Molybdate ABC transporter, permease protein
 
Vibrio angustum S14

Gene: VAS14_11344: Molybdate ABC transporter, permease protein
 
Photobacterium profundum SS9

Gene: PBPRB1348: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0724: Molybdate ABC transporter, ATP-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV20327: Molybdate ABC transporter, ATP-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05727: Molybdate ABC transporter, ATP-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0929: Molybdate ABC transporter, ATP-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_14837: Molybdate ABC transporter, ATP-binding protein
 
Vibrio splendidus LGP32

Gene: VS_II0725: Molybdate ABC transporter, ATP-binding protein
 
Vibrio fischeri ES114

Gene: VF_A0292: Molybdate ABC transporter, ATP-binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0780: Molybdate ABC transporter, ATP-binding protein
 
Vibrio angustum S14

Gene: VAS14_11349: Molybdate ABC transporter, ATP-binding protein
 
Photobacterium profundum SS9

Gene: PBPRB1347: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD