Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 6 1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110 6 1
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsB
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -124
score = 6.80178
sequence = AAGCGCAAACGTTTGCGCAA

Gene: Aave_4196: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -95
score = 6.62679
sequence = ATTAGCAAACGTTTGCGCAA

Gene: Vapar_4636: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2133: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4197: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4637: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2132: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4198: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4638: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2131: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsR
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4199: Transcriptional repressor of ribose utilization, LacI family
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4639: Transcriptional repressor of ribose utilization, LacI family
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Transcriptional repressor of ribose utilization, LacI family
rbsK
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4200: Ribokinase (EC 2.7.1.15)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4640: Ribokinase (EC 2.7.1.15)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2130: Ribokinase (EC 2.7.1.15)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Ribokinase (EC 2.7.1.15)
rbsD
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4201: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4641: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD