Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 5 1
Burkholderia mallei ATCC 23344
Burkholderia sp. 383 5 1
Burkholderia cepacia AMMD 5 1
Burkholderia vietnamiensis G4 5 1
Burkholderia glumae BGR1 5 1
Burkholderia xenovorans LB400 4 1
Burkholderia phymatum STM815 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsB
*
Burkholderia pseudomallei K96243

Site:
position = -75
score = 6.3135
sequence = CTGCGCAAACGTTTGCTCGT

Gene: BPSL1834: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -78
score = 6.506
sequence = TGGCGCAAACGTTTGCTCAC

Gene: Bcep18194_A4745: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Burkholderia cepacia AMMD

Site:
position = -77
score = 6.68751
sequence = GGGCGCAAACGTTTGCTCGC

Gene: Bamb_1503: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Burkholderia vietnamiensis G4

Site:
position = -80
score = 6.14838
sequence = TAGCGCAAACGTTTGCTTGC

Gene: Bcep1808_1558: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Burkholderia glumae BGR1

Site:
position = -70
score = 6.56185
sequence = TCGAGCAAACGTTTGCTCAA

Gene: bglu_1g18680: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*2
Burkholderia xenovorans LB400

Gene: Bxe_B0573: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)

Site:
position = -84
score = 6.46467
sequence = CCTCGCAAACGTTTGCGCGC

Gene: Bxe_A1997: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Burkholderia phymatum STM815

Site:
position = -65
score = 6.56828
sequence = GCTCGCAAACGTTTGCGCAC

Gene: Bphy_1237: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsA
 
Burkholderia pseudomallei K96243

Gene: BPSL1833: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A4746: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Burkholderia cepacia AMMD

Gene: Bamb_1504: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1559: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Burkholderia glumae BGR1

Gene: bglu_1g18670: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 2
Burkholderia xenovorans LB400

Gene: Bxe_B0574: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)

Gene: Bxe_A1998: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Burkholderia phymatum STM815

Gene: Bphy_1236: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Burkholderia pseudomallei K96243

Gene: BPSL1832: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A4747: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Burkholderia cepacia AMMD

Gene: Bamb_1505: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1560: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Burkholderia glumae BGR1

Gene: bglu_1g18660: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 2
Burkholderia xenovorans LB400

Gene: Bxe_B0575: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)

Gene: Bxe_A1999: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Burkholderia phymatum STM815

Gene: Bphy_1235: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsR
 
Burkholderia pseudomallei K96243

Gene: BPSL1831: Transcriptional repressor of ribose utilization, LacI family
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A4748: Transcriptional repressor of ribose utilization, LacI family
 
Burkholderia cepacia AMMD

Gene: Bamb_1506: Transcriptional repressor of ribose utilization, LacI family
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1561: Transcriptional repressor of ribose utilization, LacI family
 
Burkholderia glumae BGR1

Gene: bglu_1g18650: Transcriptional repressor of ribose utilization, LacI family
 
Burkholderia xenovorans LB400

Gene: Bxe_A2000: Transcriptional repressor of ribose utilization, LacI family
 
Burkholderia phymatum STM815

Gene: Bphy_1234: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
rbsK
 
Burkholderia pseudomallei K96243

Gene: BPSL1830: Ribokinase (EC 2.7.1.15)
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A4749: Ribokinase (EC 2.7.1.15)
 
Burkholderia cepacia AMMD

Gene: Bamb_1507: Ribokinase (EC 2.7.1.15)
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1562: Ribokinase (EC 2.7.1.15)
 
Burkholderia glumae BGR1

Gene: bglu_1g18640: Ribokinase (EC 2.7.1.15)
 
Burkholderia xenovorans LB400

Gene: Bxe_B0576: Ribokinase (EC 2.7.1.15)
 
Burkholderia phymatum STM815

Gene: Bphy_1233: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD