Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 5 1
Pseudomonas entomophila L48 7 1
Pseudomonas putida KT2440 7 1
Pseudomonas syringae pv. tomato str. DC3000 7 1
Pseudomonas fluorescens Pf-5 7 1
Pseudomonas mendocina ymp
Pseudomonas stutzeri A1501
Azotobacter vinelandii AvOP
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsB
*
Pseudomonas aeruginosa PAO1

Site:
position = -76
score = 6.5259
sequence = TAACGCAAACGTTTGCGTCT

Gene: PA1946: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Pseudomonas entomophila L48

Site:
position = -52
score = 6.55293
sequence = CACCGCAAACGTTTGCGATC

Gene: PSEEN1952: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Pseudomonas putida KT2440

Site:
position = -53
score = 6.44527
sequence = CAACGCAAACGTTTGCTATC

Gene: PP2454: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -84
score = 6.63194
sequence = CCTCGCAAACGTTTGCGTGT

Gene: PSPTO2367: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Pseudomonas fluorescens Pf-5

Site:
position = -140
score = 6.29544
sequence = TTACGCAAACGTTTGCGCGG

Gene: PFL_2101: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsA
 
Pseudomonas aeruginosa PAO1

Gene: PA1947: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Pseudomonas entomophila L48

Gene: PSEEN1953: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Pseudomonas putida KT2440

Gene: PP2455: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2368: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2102: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Pseudomonas aeruginosa PAO1

Gene: PA1948: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Pseudomonas entomophila L48

Gene: PSEEN1954: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Pseudomonas putida KT2440

Gene: PP2456: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2369: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2103: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsR
 
Pseudomonas aeruginosa PAO1

Gene: PA1949: Transcriptional repressor of ribose utilization, LacI family
 
Pseudomonas entomophila L48

Gene: PSEEN1955: Transcriptional repressor of ribose utilization, LacI family
 
Pseudomonas putida KT2440

Gene: PP2457: Transcriptional repressor of ribose utilization, LacI family
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2370: Transcriptional repressor of ribose utilization, LacI family
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2104: Transcriptional repressor of ribose utilization, LacI family
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Transcriptional repressor of ribose utilization, LacI family
rbsK
 
Pseudomonas aeruginosa PAO1

Gene: PA1950: Ribokinase (EC 2.7.1.15)
 
Pseudomonas entomophila L48

Gene: PSEEN1956: Ribokinase (EC 2.7.1.15)
 
Pseudomonas putida KT2440

Gene: PP2458: Ribokinase (EC 2.7.1.15)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2371: Ribokinase (EC 2.7.1.15)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2105: Ribokinase (EC 2.7.1.15)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Ribokinase (EC 2.7.1.15)
rbsD
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN1957: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Pseudomonas putida KT2440

Gene: PP2459: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2372: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2106: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
uriH
 
Pseudomonas aeruginosa PAO1

Gene: PA0143: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
 
Pseudomonas entomophila L48

Gene: PSEEN1958: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
 
Pseudomonas putida KT2440

Gene: PP2460: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2373: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2107: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD