Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 6 1
Psychromonas sp. CNPT3 6 1
Moritella sp. PE36 6 1
Aeromonas hydrophila subsp. hydrophila ATCC 7966 6 1
Aeromonas salmonicida subsp. salmonicida A449 1 1
Tolumonas auensis DSM 9187 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsD
*
Psychromonas ingrahamii 37

Site:
position = -107
score = 5.60385
sequence = CCATCGAAACGTTTGCGCAA

Gene: Ping_0340: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Psychromonas sp. CNPT3

Site:
position = -94
score = 5.72743
sequence = TTATCGAAACGTTTGCGCAA

Site:
position = -82
score = 5.60385
sequence = TTGCGCAAACGTTTCGATGG

Gene: PCNPT3_07068: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Moritella sp. PE36

Site:
position = -82
score = 5.60385
sequence = TTGCGCAAACGTTTCGATGG

Site:
position = -94
score = 5.60385
sequence = CCATCGAAACGTTTGCGCAA

Gene: PE36_05828: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -72
score = 5.42914
sequence = TGACGCAACCGGTTGCGTAA

Gene: AHA_2309: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -75
score = 5.42914
sequence = TGACGCAACCGGTTGCGTAA

Gene: ASA_1971: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*2
Tolumonas auensis DSM 9187

Site:
position = -139
score = 5.48485
sequence = CCATCGAAACGTTTCGATGG

Gene: Tola_0571: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)

Gene: Tola_0569: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Psychromonas ingrahamii 37

Gene: Ping_0341: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07073: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Moritella sp. PE36

Gene: PE36_05823: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2310: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187

Gene: Tola_0572: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Psychromonas ingrahamii 37

Gene: Ping_0342: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07078: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Moritella sp. PE36

Gene: PE36_05818: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2311: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1969: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Tolumonas auensis DSM 9187

Gene: Tola_0573: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Psychromonas ingrahamii 37

Gene: Ping_0343: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07083: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Moritella sp. PE36

Gene: PE36_05813: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2312: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1968: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Tolumonas auensis DSM 9187

Gene: Tola_0574: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK
 
Psychromonas ingrahamii 37

Gene: Ping_0344: Ribokinase (EC 2.7.1.15)
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07088: Ribokinase (EC 2.7.1.15)
 
Moritella sp. PE36

Gene: PE36_05808: Ribokinase (EC 2.7.1.15)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2313: Ribokinase (EC 2.7.1.15)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1967: Ribokinase (EC 2.7.1.15)
 2
Tolumonas auensis DSM 9187

Gene: Tola_0575: Ribokinase (EC 2.7.1.15)

Gene: Tola_0570: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsR
 
Psychromonas ingrahamii 37

Gene: Ping_0345: Transcriptional repressor of ribose utilization, LacI family
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07093: Transcriptional repressor of ribose utilization, LacI family
 
Moritella sp. PE36

Gene: PE36_05803: Transcriptional repressor of ribose utilization, LacI family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2314: Transcriptional repressor of ribose utilization, LacI family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1966: Transcriptional repressor of ribose utilization, LacI family
 
Tolumonas auensis DSM 9187

Gene: Tola_0576: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD