Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20 6 1
Aggregatibacter aphrophilus NJ8700
Pasteurella multocida subsp. multocida str. Pm70 6 1
Mannheimia succiniciproducens MBEL55E
Actinobacillus succinogenes 130Z 6 1
Haemophilus somnus 2336 6 1
Actinobacillus pleuropneumoniae serovar 7 str. AP76 5 1
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsD
*
Haemophilus influenzae Rd KW20

Site:
position = -37
score = 6.03742
sequence = TTATCGAAACGTTTCGATAA

Gene: HI0501: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Aggregatibacter aphrophilus NJ8700
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -46
score = 6.12927
sequence = TCATCGAAACGTTTCGATGA

Gene: PM0156: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Mannheimia succiniciproducens MBEL55E
*
Actinobacillus succinogenes 130Z

Site:
position = -51
score = 6.10058
sequence = TCATCGAAACGTTTCGATAA

Gene: Asuc_0194: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Haemophilus somnus 2336

Site:
position = -72
score = 5.87731
sequence = TAATCGAAACGTTTCGATGA

Gene: HSM_0089: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -48
score = 6.10058
sequence = TCATCGAAACGTTTCGATAA

Gene: APP7_1729: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -40
score = 6.28167
sequence = TCATCGAAACGTTTCGATGG

Gene: HAPS_1629: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Haemophilus influenzae Rd KW20

Gene: HI0502: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0155: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0195: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Haemophilus somnus 2336

Gene: HSM_0090: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1730: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1630: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Haemophilus influenzae Rd KW20

Gene: HI0503: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0154: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0196: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Haemophilus somnus 2336

Gene: HSM_0091: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1731: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1631: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Haemophilus influenzae Rd KW20

Gene: HI0504: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0153: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0197: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Haemophilus somnus 2336

Gene: HSM_0092: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1732: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1632: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK
 
Haemophilus influenzae Rd KW20

Gene: HI0505: Ribokinase (EC 2.7.1.15)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0080: Ribokinase (EC 2.7.1.15)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0152: Ribokinase (EC 2.7.1.15)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0283: Ribokinase (EC 2.7.1.15)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0198: Ribokinase (EC 2.7.1.15)
 
Haemophilus somnus 2336

Gene: HSM_0093: Ribokinase (EC 2.7.1.15)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1733: Ribokinase (EC 2.7.1.15)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1633: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsR
 
Haemophilus influenzae Rd KW20

Gene: HI0506: Transcriptional repressor of ribose utilization, LacI family
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0151: Transcriptional repressor of ribose utilization, LacI family
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0284: Transcriptional repressor of ribose utilization, LacI family
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0199: Transcriptional repressor of ribose utilization, LacI family
 
Haemophilus somnus 2336

Gene: HSM_0094: Transcriptional repressor of ribose utilization, LacI family
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1728: Transcriptional repressor of ribose utilization, LacI family
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_1628: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD