Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 6 1
Vibrio vulnificus CMCP6 6 1
Vibrio harveyi ATCC BAA-1116 6 1
Vibrio parahaemolyticus RIMD 2210633 6 1
Vibrio shilonii AK1 6 1
Vibrio splendidus LGP32 6 1
Vibrio fischeri ES114 6 1
Vibrio salmonicida LFI1238 6 1
Vibrio angustum S14 6 1
Photobacterium profundum SS9 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsD
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -86
score = 6.98537
sequence = TCATCGAAACGTTTCGATGT

Gene: VCA0127: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio vulnificus CMCP6

Site:
position = -72
score = 7.17982
sequence = TCATCGAAACGTTTCGATGA

Gene: VV20061: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -222
score = 6.18918
sequence = CTATCGAAACGTTTCGATTT

Site:
position = -95
score = 6.98537
sequence = TCATCGAAACGTTTCGATGT

Gene: VIBHAR_06146: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -226
score = 7.04507
sequence = CCATCGAAACGTTTCGATGA

Site:
position = -96
score = 6.69483
sequence = GCATCGAAACGTTTCGATGA

Gene: VPA1087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio shilonii AK1

Site:
position = -170
score = 6.56707
sequence = TCATCGAAACGTTTCGATAG

Site:
position = -87
score = 7.17982
sequence = TCATCGAAACGTTTCGATGA

Gene: VSAK1_16182: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio splendidus LGP32

Site:
position = -26
score = 6.62481
sequence = CTATCGAAACGTTTCGATGG

Site:
position = -104
score = 7.04507
sequence = CCATCGAAACGTTTCGATGA

Gene: VS_II0940: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio fischeri ES114

Site:
position = -71
score = 6.39547
sequence = TTACGCAAACGTTTCGATGA

Gene: VF_1444: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio salmonicida LFI1238

Site:
position = -70
score = 6.39547
sequence = TTACGCAAACGTTTCGATGA

Gene: VSAL_I1372: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Vibrio angustum S14

Site:
position = -226
score = 6.75955
sequence = TTATCGAAACGTTTCGATGG

Site:
position = -96
score = 6.62481
sequence = CTATCGAAACGTTTCGATGG

Gene: VAS14_09005: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Photobacterium profundum SS9

Site:
position = -118
score = 5.73617
sequence = CCATCGAAACGTTTGCGTAA

Gene: PBPRB1556: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0128: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio vulnificus CMCP6

Gene: VV20062: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06145: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1086: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio shilonii AK1

Gene: VSAK1_16177: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio splendidus LGP32

Gene: VS_II0941: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio fischeri ES114

Gene: VF_1445: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1371: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Vibrio angustum S14

Gene: VAS14_09010: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Photobacterium profundum SS9

Gene: PBPRB1557: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0129: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio vulnificus CMCP6

Gene: VV20063: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06144: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1085: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio shilonii AK1

Gene: VSAK1_16172: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio splendidus LGP32

Gene: VS_II0942: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio fischeri ES114

Gene: VF_1446: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1370: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Vibrio angustum S14

Gene: VAS14_09015: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Photobacterium profundum SS9

Gene: PBPRB1558: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0130: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio vulnificus CMCP6

Gene: VV20064: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06143: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1084: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio shilonii AK1

Gene: VSAK1_16167: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio splendidus LGP32

Gene: VS_II0943: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio fischeri ES114

Gene: VF_1447: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1369: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Vibrio angustum S14

Gene: VAS14_09020: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Photobacterium profundum SS9

Gene: PBPRB1559: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0131: Ribokinase (EC 2.7.1.15)
 
Vibrio vulnificus CMCP6

Gene: VV20065: Ribokinase (EC 2.7.1.15)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06142: Ribokinase (EC 2.7.1.15)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1083: Ribokinase (EC 2.7.1.15)
 
Vibrio shilonii AK1

Gene: VSAK1_16162: Ribokinase (EC 2.7.1.15)
 
Vibrio splendidus LGP32

Gene: VS_II0944: Ribokinase (EC 2.7.1.15)
 
Vibrio fischeri ES114

Gene: VF_1448: Ribokinase (EC 2.7.1.15)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1368: Ribokinase (EC 2.7.1.15)
 
Vibrio angustum S14

Gene: VAS14_09025: Ribokinase (EC 2.7.1.15)
 
Photobacterium profundum SS9

Gene: PBPRB1560: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsR
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0132: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio vulnificus CMCP6

Gene: VV20066: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06141: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1082: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio shilonii AK1

Gene: VSAK1_16157: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio splendidus LGP32

Gene: VS_II0945: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio fischeri ES114

Gene: VF_1449: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1367: Transcriptional repressor of ribose utilization, LacI family
 
Vibrio angustum S14

Gene: VAS14_09030: Transcriptional repressor of ribose utilization, LacI family
 
Photobacterium profundum SS9

Gene: PBPRB1561: Transcriptional repressor of ribose utilization, LacI family
Transcriptional repressor of ribose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD