Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 5 1
Ralstonia pickettii 12J 5 1
Ralstonia metallidurans CH34
Ralstonia eutropha JMP134
Ralstonia eutropha H16
Cupriavidus taiwanensis
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsB
*
Ralstonia solanacearum GMI1000

Site:
position = -108
score = 6.72758
sequence = ATACGCAAACGTTTGCGAGC

Gene: RS04260: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
*
Ralstonia pickettii 12J

Site:
position = -119
score = 6.90418
sequence = GTACGCAAACGTTTGCGAAG

Gene: Rpic_0882: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsA
 
Ralstonia solanacearum GMI1000

Gene: RS04262: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Ralstonia pickettii 12J

Gene: Rpic_0881: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Ralstonia solanacearum GMI1000

Gene: RS04264: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Ralstonia pickettii 12J

Gene: Rpic_0880: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsR
 
Ralstonia solanacearum GMI1000

Gene: RS04266: Transcriptional repressor of ribose utilization, LacI family
 
Ralstonia pickettii 12J

Gene: Rpic_0879: Transcriptional repressor of ribose utilization, LacI family
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Transcriptional repressor of ribose utilization, LacI family
rbsK
 
Ralstonia solanacearum GMI1000

Gene: RS04269: Ribokinase (EC 2.7.1.15)
 
Ralstonia pickettii 12J

Gene: Rpic_0878: Ribokinase (EC 2.7.1.15)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Ribokinase (EC 2.7.1.15)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD