Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 6 1
Desulfovibrio magneticus RS-1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028
Desulfohalobium retbaense DSM 5692
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsD
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -76
score = 4.4644
sequence = TTGCGCAAACGTTTCGATGA

Gene: Desal_2553: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2552: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2551: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2550: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2549: Ribokinase (EC 2.7.1.15)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Ribokinase (EC 2.7.1.15)
rbsR
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2548: Transcriptional repressor of ribose utilization, LacI family
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Transcriptional repressor of ribose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD