Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate; Fructose-1,6-diphosphate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043 10 5
Reinekea sp. MED297 4 2
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pgi
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_1348: Glucose-6-phosphate isomerase (EC 5.3.1.9)
*
Chromohalobacter salexigens DSM 3043

Site:
position = -69
score = 5.78944
sequence = AAGCTGACACGATTCATCCA

Gene: Csal_0932: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Glucose-6-phosphate isomerase (EC 5.3.1.9)
pfkB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4346: Fructokinase (EC 2.7.1.4)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0931: Fructokinase (EC 2.7.1.4)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Fructokinase (EC 2.7.1.4)
 
CRON 2.
COG2814
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -67
score = 4.7886
sequence = ACGCTGATTCGATTCAGCAC

Gene: Csal_0500: Sugar MFS transporter, AraJ family
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Sugar MFS transporter, AraJ family
 
CRON 3.
gap
 
Hahella chejuensis KCTC 2396

Gene: HCH_01536: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Marinobacter aqueolei

Gene: Maqu_3039: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Marinobacter sp. ELB17

Gene: MELB17_04867: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Oceanobacter sp. RED65

Gene: RED65_05737: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Oceanospirillum sp. MED92

Gene: MED92_07231: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4318: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -15
score = 5.01684
sequence = GAGCTGAATCGTGTCATGCC

Gene: Csal_0372: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_2614: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
pgk
 
Hahella chejuensis KCTC 2396

Gene: HCH_01537: Phosphoglycerate kinase (EC 2.7.2.3)
 
Marinobacter aqueolei

Gene: Maqu_3038: Phosphoglycerate kinase (EC 2.7.2.3)
 
Marinobacter sp. ELB17

Gene: MELB17_04872: Phosphoglycerate kinase (EC 2.7.2.3)
 
Oceanobacter sp. RED65

Gene: RED65_05752: Phosphoglycerate kinase (EC 2.7.2.3)
 
Oceanospirillum sp. MED92

Gene: MED92_07236: Phosphoglycerate kinase (EC 2.7.2.3)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4317: Phosphoglycerate kinase (EC 2.7.2.3)
 
Saccharophagus degradans 2-40

Gene: Sde_0473: Phosphoglycerate kinase (EC 2.7.2.3)
 
Teredinibacter turnerae T7901

Gene: TERTU_3969: Phosphoglycerate kinase (EC 2.7.2.3)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0211: Phosphoglycerate kinase (EC 2.7.2.3)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0371: Phosphoglycerate kinase (EC 2.7.2.3)
 
Reinekea sp. MED297

Gene: MED297_10216: Phosphoglycerate kinase (EC 2.7.2.3)
 
Alcanivorax borkumensis SK2

Gene: ABO_2613: Phosphoglycerate kinase (EC 2.7.2.3)
Phosphoglycerate kinase (EC 2.7.2.3)
fba
 
Hahella chejuensis KCTC 2396

Gene: HCH_01538: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Marinobacter aqueolei

Gene: Maqu_3037: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Marinobacter sp. ELB17

Gene: MELB17_04877: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Oceanobacter sp. RED65

Gene: RED65_05757: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Oceanospirillum sp. MED92

Gene: MED92_07241: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4316: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0370: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_2612: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
CRON 4.
fruR
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -161
score = 5.57975
sequence = GGGCTGAATCGTGTCAGCTA

Gene: Csal_2649: Fructose operon transcriptional regulator FruR, LacI family
*
Reinekea sp. MED297

Site:
position = -63
score = 4.53706
sequence = AAGCTGAATGCATTCAGCAA

Site:
position = -197
score = 4.38263
sequence = ATACTGAAACGGTTCAGCAG

Gene: MED297_11620: Fructose operon transcriptional regulator FruR, LacI family
 
Alcanivorax borkumensis SK2
Fructose operon transcriptional regulator FruR, LacI family
 
CRON 5.
fruB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -118
score = 5.57975
sequence = TAGCTGACACGATTCAGCCC

Gene: Csal_2648: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) / Fructose-specific phosphocarrier protein HPr (EC 2.7.1.69) / PTS system, fructose-specific IIA component (EC 2.7.1.69)
*
Reinekea sp. MED297

Site:
position = -41
score = 4.38263
sequence = CTGCTGAACCGTTTCAGTAT

Site:
position = -175
score = 4.53706
sequence = TTGCTGAATGCATTCAGCTT

Gene: MED297_11615: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) / Fructose-specific phosphocarrier protein HPr (EC 2.7.1.69) / PTS system, fructose-specific IIA component (EC 2.7.1.69)
 
Alcanivorax borkumensis SK2
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) / Fructose-specific phosphocarrier protein HPr (EC 2.7.1.69) / PTS system, fructose-specific IIA component (EC 2.7.1.69)
fruK
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2647: 1-phosphofructokinase (EC 2.7.1.56)
 
Reinekea sp. MED297

Gene: MED297_11610: 1-phosphofructokinase (EC 2.7.1.56)
 
Alcanivorax borkumensis SK2
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2646: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Reinekea sp. MED297

Gene: MED297_11605: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Alcanivorax borkumensis SK2
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD