Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KdgR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20
Aggregatibacter aphrophilus NJ8700
Pasteurella multocida subsp. multocida str. Pm70
Mannheimia succiniciproducens MBEL55E 13 6
Actinobacillus succinogenes 130Z 13 6
Haemophilus somnus 2336
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
togX
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -99
score = 6.05124
sequence = AAATAAAACAATGTTTTAAAT

Gene: MS1741: predicted oligogalacturonate transporter
*
Actinobacillus succinogenes 130Z

Site:
position = -97
score = 5.82035
sequence = AAATAAAATTTTGTTTCAAAA

Site:
position = -102
score = 5.04863
sequence = ATTAAAAATAAAATTTTGTTT

Gene: Asuc_1468: predicted oligogalacturonate transporter
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
predicted oligogalacturonate transporter
ogl
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1740: Oligogalacturonate lyase (EC 4.2.2.6)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1467: Oligogalacturonate lyase (EC 4.2.2.6)
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Oligogalacturonate lyase (EC 4.2.2.6)
 
CRON 2.
pelX
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -124
score = 4.82169
sequence = TAATAAAATAAAACATTATTT

Site:
position = -119
score = 6.05124
sequence = AAATAAAACATTATTTCAAAT

Gene: MS1742: Exopolygalacturonate lyase (EC 4.2.2.9)
*
Actinobacillus succinogenes 130Z

Site:
position = -73
score = 5.19626
sequence = AAATAAAATTGTGTTATATTA

Site:
position = -117
score = 5.79232
sequence = TATTAAAATAATGTTTCAAAA

Gene: Asuc_1469: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Exopolygalacturonate lyase (EC 4.2.2.9)
 
CRON 3.
kduD
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -88
score = 5.94981
sequence = AAATGAAATTATGTTTTATAT

Gene: MS0563: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
*
Actinobacillus succinogenes 130Z

Site:
position = -122
score = 5.44366
sequence = AATTGAAATTGTATTTCAGAA

Gene: Asuc_1474: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
spiX
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0564: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1473: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
kdgK
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0565: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1472: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
eda
 
Haemophilus influenzae Rd KW20

Gene: HI0047: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0021: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0947: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0566: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1471: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Haemophilus somnus 2336

Gene: HSM_0408: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
kdgF
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0567: Pectin degradation protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1470: Pectin degradation protein
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Pectin degradation protein
 
CRON 4.
kdgR
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -126
score = 5.94981
sequence = ATATAAAACATAATTTCATTT

Gene: MS0562: 2-keto-3-deoxygluconate regulator, IclR family
*
Actinobacillus succinogenes 130Z

Site:
position = -126
score = 5.44366
sequence = TTCTGAAATACAATTTCAATT

Gene: Asuc_1475: 2-keto-3-deoxygluconate regulator, IclR family
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
2-keto-3-deoxygluconate regulator, IclR family
 
CRON 5.
oglO
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0419: predicted oligogalacturonate-specific outer membrane porin
 2
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0389: predicted oligogalacturonate-specific outer membrane porin

Gene: PM0388: predicted oligogalacturonate-specific outer membrane porin
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -208
score = 5.05066
sequence = ATTAAAAATAAAATTTTAGAA

Site:
position = -170
score = 5.94633
sequence = TTTTAAAATATTGTTTTATTT

Site:
position = -107
score = 5.32864
sequence = ATTTGACATAGTGTTTCAATT

Gene: MS0561: predicted oligogalacturonate-specific outer membrane porin
*
Actinobacillus succinogenes 130Z

Site:
position = -148
score = 5.43415
sequence = TTTTAAAACCATATTTCAATT

Gene: Asuc_1477: predicted oligogalacturonate-specific outer membrane porin
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
predicted oligogalacturonate-specific outer membrane porin
 
CRON 6.
oglP
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -155
score = 6.12521
sequence = AATTAAAATAATGTTTTATTT

Gene: MS0698: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
*
Actinobacillus succinogenes 130Z

Site:
position = -153
score = 5.54167
sequence = ATTCAAAACATAATTTCATTT

Gene: Asuc_1923: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
predicted oligogalacturonate TRAP transporter, substrate-binding subunit
oglQ
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0697: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1922: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
predicted oligogalacturonate TRAP transporter, small transmembrane subunit
oglM
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0696: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1921: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
predicted oligogalacturonate TRAP transporter, large transmembrane subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD