Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog KdgR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 40 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio vulnificus CMCP6 14 7
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633 12 6
Vibrio shilonii AK1 12 4
Vibrio splendidus LGP32
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14
Photobacterium profundum SS9 15 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
togX1
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -93
score = 5.48939
sequence = AAATGAACCGTTGTTTTGATT

Site:
position = -29
score = 5.13607
sequence = AATTAAAACAGCGTTTCGAGG

Gene: VPA0087: predicted oligogalacturonate transporter
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -149
score = 5.52979
sequence = AAATGAACCGTTGTTTCGATT

Site:
position = -85
score = 5.31033
sequence = AATTAAAACGGCGTTTCGAGG

Gene: PBPRB1723: predicted oligogalacturonate transporter
predicted oligogalacturonate transporter
ogl
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0088: Oligogalacturonate lyase (EC 4.2.2.6)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1722: Oligogalacturonate lyase (EC 4.2.2.6)
Oligogalacturonate lyase (EC 4.2.2.6)
 
CRON 2.
VSAK1_20364
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -189
score = 5.79489
sequence = TATTAAAACGCCGTTTTAATA

Gene: VSAK1_20364: Heparinase II/III-like protein
 
Vibrio splendidus LGP32

Gene: VS_1246: Heparinase II/III-like protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Heparinase II/III-like protein
VSAK1_20369
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_20369: Heparinase II/III-like protein
 
Vibrio splendidus LGP32

Gene: VS_1247: Heparinase II/III-like protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Heparinase II/III-like protein
togX2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -130
score = 5.19003
sequence = TTTTGAAACACCATTTTATTT

Site:
position = -40
score = 5.22216
sequence = CTTTAAAACGGTGTTTTAATT

Gene: VPA0084: predicted oligogalacturonate transporter
 
Vibrio shilonii AK1

Gene: VSAK1_20374: predicted oligogalacturonate transporter
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
predicted oligogalacturonate transporter
 
CRON 3.
kdgM
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -110
score = 5.44752
sequence = AATTAAAACACCGTTTTAAAG

Site:
position = -20
score = 5.53499
sequence = AAATAAAATGGTGTTTCAAAA

Gene: VPA0085: Oligogalacturonate-specific porin protein KdgM
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -122
score = 5.56897
sequence = AATTAAAACGCCGTTTCAATG

Site:
position = -32
score = 5.8477
sequence = AATTAAAACGGCGTTTTAAAA

Gene: PBPRB1726: Oligogalacturonate-specific porin protein KdgM
Oligogalacturonate-specific porin protein KdgM
pelX
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0086: Exopolygalacturonate lyase (EC 4.2.2.9)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1725: Exopolygalacturonate lyase (EC 4.2.2.9)
Exopolygalacturonate lyase (EC 4.2.2.9)
 
CRON 4.
kduI
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio shilonii AK1

Site:
position = -164
score = 5.4894
sequence = TTTTAAAACGCAGTTTCAAAA

Gene: VSAK1_02644: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -124
score = 5.3854
sequence = TTTTGAAACGATGTATCAATA

Gene: PBPRB1731: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
oglP
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_02649: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1730: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
predicted oligogalacturonate TRAP transporter, substrate-binding subunit
oglQ
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_02654: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1729: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
predicted oligogalacturonate TRAP transporter, small transmembrane subunit
oglM
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_02659: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1728: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
predicted oligogalacturonate TRAP transporter, large transmembrane subunit
kdgR2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1

Gene: VSAK1_02664: Transcriptional regulator, IclR family
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1727: Transcriptional regulator, IclR family
Transcriptional regulator, IclR family
 
CRON 5.
VV21107
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -114
score = 5.81008
sequence = TATTGAAATGATGTTTCAAAA

Site:
position = -67
score = 5.48069
sequence = AAATAAAAAGATGTTTTAAAA

Gene: VV21107: Arylsulfatase regulator
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Arylsulfatase regulator
 
CRON 6.
VV21108
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -115
score = 5.3116
sequence = TTTTAAAACATCTTTTTATTT

Site:
position = -68
score = 5.64514
sequence = TTTTGAAACATCATTTCAATA

Gene: VV21108: Putative sulfatase (EC 3.1.6.-)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Putative sulfatase (EC 3.1.6.-)
VV21109
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21109: Arylsulfatase (EC 3.1.6.1)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Arylsulfatase (EC 3.1.6.1)
 
CRON 7.
ugl
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -127
score = 5.50465
sequence = AATTGAAAAGGTGTTTTGAAA

Gene: VV21092: Unsaturated glucuronyl hydrolase, protein containing a thioredoxin domain
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Unsaturated glucuronyl hydrolase, protein containing a thioredoxin domain
VV21091
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21091: Putative 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Putative 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase
cslA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV21090: Chondroitinase AC precursor (EC 4.2.2.5)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Chondroitinase AC precursor (EC 4.2.2.5)
 
CRON 8.
VV21106
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -162
score = 5.47539
sequence = TATTGAAACGCTTTTTTATAT

Site:
position = -56
score = 5.17252
sequence = AATTGAACCATCATTTCATTT

Gene: VV21106: Arylsulfatase A
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Arylsulfatase A
 
CRON 9.
kduD
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -189
score = 5.23125
sequence = TTTTAAAATACCTTTTCATAA

Site:
position = -115
score = 6.0113
sequence = TTTTGAAACGTCTTTTCAAAA

Gene: VV20914: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -194
score = 5.62217
sequence = TTTTAAAATGCCTTTTCAAAA

Site:
position = -121
score = 5.82453
sequence = TTTTAAAACGCCTTTTCAAAA

Gene: VPA0077: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
*
Vibrio shilonii AK1

Site:
position = -195
score = 4.77501
sequence = TTTCAAAAAGGCTTTTCATAA

Site:
position = -119
score = 5.61664
sequence = AAATGAAACGGCATTTCAAAA

Gene: VSAK1_20309: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -194
score = 5.56589
sequence = TTTTAAAAAGCCTTTTCAAAA

Site:
position = -121
score = 5.79029
sequence = TTTTAAAACGTTATTTCAAAA

Gene: PBPRB1737: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
ygjV
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20913: Permease of the major facilitator superfamily
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0078: Permease of the major facilitator superfamily
 
Vibrio shilonii AK1

Gene: VSAK1_20314: Permease of the major facilitator superfamily
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1736: Permease of the major facilitator superfamily
Permease of the major facilitator superfamily
kdgF
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20912: Putative pectin degradation protein
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0079: Putative pectin degradation protein
 
Vibrio shilonii AK1

Gene: VSAK1_20419: Putative pectin degradation protein
 
Vibrio splendidus LGP32

Gene: VS_1244: Putative pectin degradation protein
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1735: Putative pectin degradation protein
Putative pectin degradation protein
spiX
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20911: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0080: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Vibrio shilonii AK1

Gene: VSAK1_20319: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1734: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
kdgK
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -81
score = 5.73786
sequence = AATTGAACCATTGTTTTAAAA

Gene: VV20905: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -82
score = 5.39868
sequence = AAATGAACCGTTGTTTTATTT

Gene: VPA0082: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Vibrio shilonii AK1

Gene: VSAK1_20349: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Vibrio splendidus LGP32

Gene: VS_1243: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -81
score = 5.41705
sequence = TTATGAACCGATGTTTTATTT

Gene: PBPRB1733: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
eda
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20904: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0083: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Vibrio shilonii AK1

Gene: VSAK1_20344: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Vibrio splendidus LGP32

Gene: VS_1242: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRB1732: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
CRON 10.
kdgR
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -234
score = 4.89379
sequence = AAGTGAACCGACGTTTTGGTT

Site:
position = -158
score = 5.8346
sequence = TTTTGAAAAGACGTTTCAAAA

Site:
position = -84
score = 5.358
sequence = TTATGAAAAGGTATTTTAAAA

Gene: VV20915: 2-keto-3-deoxygluconate regulator KdgR
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -140
score = 5.7518
sequence = TTTTGAAAAGGCGTTTTAAAA

Site:
position = -67
score = 5.50876
sequence = TTTTGAAAAGGCATTTTAAAA

Gene: VPA0076: 2-keto-3-deoxygluconate regulator KdgR
*
Vibrio shilonii AK1

Site:
position = -161
score = 5.44539
sequence = TTTTGAAATGCCGTTTCATTT

Site:
position = -85
score = 5.37113
sequence = TTATGAAAAGCCTTTTTGAAA

Gene: VSAK1_20304: 2-keto-3-deoxygluconate regulator KdgR
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -158
score = 5.67621
sequence = TTTTGAAATAACGTTTTAAAA

Site:
position = -85
score = 5.60743
sequence = TTTTGAAAAGGCTTTTTAAAA

Gene: PBPRB1738: 2-keto-3-deoxygluconate regulator KdgR
2-keto-3-deoxygluconate regulator KdgR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD