Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36 2 2
Aeromonas hydrophila subsp. hydrophila ATCC 7966 9 4
Aeromonas salmonicida subsp. salmonicida A449 6 4
Tolumonas auensis DSM 9187 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tyrP
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -78
score = 5.50476
sequence = TTGTAAACATAAGTTTACAC

Site:
position = -196
score = 4.60315
sequence = CTGTAAATATTAGTTTCCAA

Gene: PE36_13494: Tyrosine-specific transport protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Tyrosine-specific transport protein
 
CRON 2.
tyrR
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -58
score = 4.01254
sequence = GTTGATACTGCCGTTTACAT

Gene: PE36_04363: Transcriptional regulator of aromatic amino acid biosynthesis
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1886: Transcriptional regulator of aromatic amino acid biosynthesis
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2418: Transcriptional regulator of aromatic amino acid biosynthesis
 
Tolumonas auensis DSM 9187

Gene: Tola_1927: Transcriptional regulator of aromatic amino acid biosynthesis
Transcriptional regulator of aromatic amino acid biosynthesis
 
CRON 3.
aroF
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_04938: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54) # AroA I alpha
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -59
score = 4.83986
sequence = GTGTAAATAAAAATGAACGG

Site:
position = -238
score = 4.51427
sequence = GCGTAATCATATGTTTACGT

Gene: AHA_1654: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54) # AroA I alpha
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -60
score = 5.42888
sequence = GTGTAAATAAATGAATACAC

Site:
position = -239
score = 5.36617
sequence = ATGTAACTATATATTTACGA

Gene: ASA_2704: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54) # AroA I alpha
*
Tolumonas auensis DSM 9187

Site:
position = -32
score = 5.55862
sequence = GTGTAAAGATAAGTTTACAG

Site:
position = -69
score = 4.05116
sequence = ATGTCAATACAAGATTAAAA

Gene: Tola_1376: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54) # AroA I alpha
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54) # AroA I alpha
tyrA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_04928: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) # AroHI/TyrAc, NAD-specific
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1655: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) # AroHI/TyrAc, NAD-specific
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2703: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) # AroHI/TyrAc, NAD-specific
 
Tolumonas auensis DSM 9187

Gene: Tola_1377: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) # AroHI/TyrAc, NAD-specific
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) # AroHI/TyrAc, NAD-specific
 
CRON 4.
aroG
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -82
score = 5.68918
sequence = ATGTAATTTTCTATTTACAC

Gene: AHA_1980: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -82
score = 5.68918
sequence = ATGTAATTTTCTATTTACAC

Gene: ASA_1860: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Tolumonas auensis DSM 9187

Gene: Tola_1390: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
CRON 5.
phhA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_05048: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -146
score = 5.36319
sequence = TTGTCACAAATTATTTACAA

Gene: AHA_1883: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -136
score = 5.36319
sequence = TTGTCACAAATTGTTTACAA

Gene: ASA_2420: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Tolumonas auensis DSM 9187
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_05053: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1884: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2419: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Tolumonas auensis DSM 9187
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
CRON 6.
hpd
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_16244: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -180
score = 5.27011
sequence = ATGTCACAATCTATTTACAT

Site:
position = -91
score = 4.38097
sequence = ATGAAACAAGTTGTTAACAA

Gene: AHA_2663: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -112
score = 4.38097
sequence = ATGAAACAAGTTGTTAACAA

Site:
position = -201
score = 5.27011
sequence = ATGTCACAATCTATTTACAT

Gene: ASA_2519: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Tolumonas auensis DSM 9187
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_16239: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2662: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_16234: Fumarylacetoacetase (EC 3.7.1.2)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2661: Fumarylacetoacetase (EC 3.7.1.2)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2517: Fumarylacetoacetase (EC 3.7.1.2)
 
Tolumonas auensis DSM 9187
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_16229: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_2660: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2516: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Tolumonas auensis DSM 9187
Maleylacetoacetate isomerase (EC 5.2.1.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD