Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR1 - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 5 4
Alteromonas macleodii 'Deep ecotype' 4 3
Glaciecola sp. HTCC2999 3 2
Colwellia psychrerythraea 34H 4 3
Alteromonadales bacterium TW-7 5 4
Pseudoalteromonas haloplanktis TAC125 5 4
Pseudoalteromonas tunicata D2 5 4
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phhA
*
Pseudoalteromonas atlantica T6c

Site:
position = -117
score = 5.00064
sequence = TTGTAGCTTAATGTTTACAT

Site:
position = -96
score = 4.47483
sequence = TTGTAATTTTATTGTTGCTA

Gene: Patl_2999: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -102
score = 5.23281
sequence = ATGTAAAATTTATGTTACAG

Gene: MADE_02830: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -204
score = 4.50093
sequence = ATGTAACCTTTCATGTACAA

Gene: CPS_3766: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Alteromonadales bacterium TW-7

Site:
position = -183
score = 4.67332
sequence = GTGTATTTAATTGTATACAC

Site:
position = -108
score = 5.17109
sequence = GTGTAACTTTAAATTTACGA

Gene: ATW7_09356: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -162
score = 5.41577
sequence = GTGTAATTTTAAGTGTACAA

Gene: PSHAa2043: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Pseudoalteromonas tunicata D2

Site:
position = -219
score = 4.63191
sequence = TTGTATCTTTTTGTTTACTA

Site:
position = -146
score = 5.15702
sequence = TTGTAAACAAATAATTCCAA

Gene: PTD2_15977: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Idiomarina baltica OS145

Gene: OS145_07152: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Idiomarina loihiensis L2TR

Gene: IL0725: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_3765: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Alteromonadales bacterium TW-7

Gene: ATW7_09351: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2042: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15982: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Idiomarina baltica OS145

Gene: OS145_07147: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Idiomarina loihiensis L2TR

Gene: IL0724: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
CRON 2.
tyrR1
*
Pseudoalteromonas atlantica T6c

Site:
position = -41
score = 5.57561
sequence = GTGTAATATTATCTTTACAT

Gene: Patl_2998: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -37
score = 5.37685
sequence = CTGTACATATATGTTTACAA

Gene: MADE_02829: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
*
Glaciecola sp. HTCC2999

Site:
position = -44
score = 4.77457
sequence = GTGCAACGTAATCATTACAC

Gene: GHTCC_010100011249: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
*
Colwellia psychrerythraea 34H

Site:
position = -96
score = 5.33593
sequence = TCGTAAAAATTAGTTTACAA

Gene: CPS_3764: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
*
Alteromonadales bacterium TW-7

Site:
position = -88
score = 4.93823
sequence = TTGTCCAAAAATGTTTACAA

Gene: ATW7_09938: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -88
score = 4.72039
sequence = ATGTCCAAATTTGTTTACAT

Gene: PSHAa2157: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
*
Pseudoalteromonas tunicata D2

Site:
position = -89
score = 4.46561
sequence = TTGTTCAATATTCTTTACAA

Gene: PTD2_11554: Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Transcriptional regulator of aromatic amino acid biosynthesis and degradation, TyrR family
 
CRON 3.
aroF
*
Pseudoalteromonas atlantica T6c

Site:
position = -108
score = 5.21992
sequence = TTGTAGTTATATGTTTACAT

Gene: Patl_1587: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -92
score = 5.05057
sequence = TTGTACAACAAAGTTTACAT

Gene: MADE_01711: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Glaciecola sp. HTCC2999

Site:
position = -118
score = 5.13636
sequence = GTGTAACGTAAAGTATACAC

Gene: GHTCC_010100005834: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Colwellia psychrerythraea 34H

Site:
position = -221
score = 5.30876
sequence = GTGTAAAAATAACAATACAA

Site:
position = -198
score = 4.51896
sequence = GCGTAATTAAATCTTTACGA

Gene: CPS_3954: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1588: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01712: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100005829: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Colwellia psychrerythraea 34H

Gene: CPS_3953: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
*
Alteromonadales bacterium TW-7

Site:
position = -71
score = 4.09172
sequence = TCGTATTGATTAGTTTACTT

Site:
position = -49
score = 5.04129
sequence = ATGTAAATATAGATTTACGA

Gene: ATW7_05426: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -61
score = 4.09172
sequence = TCGTATTGATTAGTTTACTT

Site:
position = -39
score = 4.50605
sequence = ATGTAAACTTAAGTTGGCGT

Gene: PSHAa0949: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
*
Pseudoalteromonas tunicata D2

Site:
position = -39
score = 4.86798
sequence = CTGTAATTATTAATTTACTA

Site:
position = -19
score = 5.12007
sequence = CTGTAAAATAAAGTTTACTA

Gene: PTD2_15912: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Idiomarina baltica OS145

Gene: OS145_10645: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Idiomarina loihiensis L2TR
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
CRON 4.
tyrP
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -110
score = 4.73598
sequence = CTGTAAAATGTAAGTTACAT

Gene: ATW7_05466: Tyrosine-specific transport protein
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -173
score = 5.18767
sequence = TTGTAAATAGATAATTACAC

Gene: PSHAa2117: Tyrosine-specific transport protein
*
Pseudoalteromonas tunicata D2

Site:
position = -116
score = 5.09953
sequence = GTGTAAATCAATTATTACAG

Gene: PTD2_03281: Tyrosine-specific transport protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Tyrosine-specific transport protein
 
CRON 5.
hpd
*
Pseudoalteromonas atlantica T6c

Site:
position = -195
score = 4.64369
sequence = CTGTAGCGTTAAGTTGACAA

Site:
position = -123
score = 4.70919
sequence = ATGTAAAGTTTATGTTACTT

Gene: Patl_2997: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_07137: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Idiomarina loihiensis L2TR

Gene: IL0722: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD