Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c 4 1
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913
Stenotrophomonas maltophilia K279a
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
trpE
*
Xylella fastidiosa 9a5c

Site:
position = -52
score = 5.92911
sequence = CGTACTGATGTACCATTACA

Gene: XF1914: Anthranilate synthase, aminase component (EC 4.1.3.27)
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpG
 
Xylella fastidiosa 9a5c

Gene: XF1915: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a
Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)
COG1541
 
Xylella fastidiosa 9a5c

Gene: XF1916: Coenzyme F390 synthetase
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a
Coenzyme F390 synthetase
SSF55729
 
Xylella fastidiosa 9a5c

Gene: XF1917: Acyl-CoA N-acyltransferase
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a
Acyl-CoA N-acyltransferase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD