Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1
Acinetobacter baumannii AB0057
Psychrobacter arcticum 273-4 3 1
Psychrobacter sp. PRwf-1 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
trpR
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
*
Psychrobacter arcticum 273-4

Site:
position = -70
score = 5.0181
sequence = TGTACTACTGTACTAGAATA

Gene: Psyc_1666: Trp operon repressor
*
Psychrobacter sp. PRwf-1

Site:
position = -48
score = 5.0181
sequence = TGTACTACTGTACTAGAATA

Gene: PsycPRwf_1155: Trp operon repressor
Trp operon repressor
trpE
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4

Gene: Psyc_1667: Anthranilate synthase, aminase component (EC 4.1.3.27)
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1154: Anthranilate synthase, aminase component (EC 4.1.3.27)
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpG
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4

Gene: Psyc_1668: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1153: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
CRON 2.
trpB
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -130
score = 4.80687
sequence = CGTATCAGTGTACTAGAACA

Gene: PsycPRwf_1460: Tryptophan synthase beta chain like (EC 4.2.1.20)
Tryptophan synthase beta chain like (EC 4.2.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD