Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3 2 1
Moritella sp. PE36 2 1
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
trpR
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -51
score = 5.49511
sequence = TGTACTGCTGTACTGTTACG

Gene: PCNPT3_05849: Trp operon repressor
*
Moritella sp. PE36

Site:
position = 3
score = 6.21122
sequence = TGTAATGCTGTACTATTACG

Gene: PE36_21864: Trp operon repressor
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Trp operon repressor
mtr
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05844: Tryptophan-specific transport protein
 
Moritella sp. PE36

Gene: PE36_21859: Tryptophan-specific transport protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Tryptophan-specific transport protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD